Description :
From Genome Similarity Track
Location :
Scaffold_93:79718- 81140
Sequence
1422 bases(100 bases per row)
GCGCTTCTCCCAGTAACCACTGGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGTAAACTCGTCCACTTGGCGCAAACTAGAGATC
TTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGC
AATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTCGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCT
GGATCAAACCATTGGCGGATCTGGTTGTAGAATTCATCCATCGGACACTTGCCCGACGTCGTGAATGTAGAAGCAATGATCCCCGGGATGACCTTTCTTG
CCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATCCCAGTGTGCTTCCCGGGATCCGCACTGCGAACACCTGACTTGTGCTGTCCCGTCCATGAT
ATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGGCGCAGTGAGACAG
ACTCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGACTCAGTTCCTGAGTCAGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCG
TGGGCGTCGGGGCCTTTTGGCGAAACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGTACTTCCTCAAGCTC
ATCTGCGTCTGGAAGACGTAACAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAGTGATCCACATGTTCCCGCAGTACCTTGGAT
CCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGT
ATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAAATTGCGCAGAAAACCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGAT
ACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCAACTTGACTTTGCTGAT
CCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCC
GCCTTGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACT
CCATCTCCACGTCTCGTGCTCC