Description :
From Genome Similarity Track
Location :
Scaffold_407:7971- 9579
Transcript NameFunction/comments
Phyta_totarag8007conserved hypothetical protein
Phyta_totarag8008hypothetical protein

Sequence
1608 bases(100 bases per row)
CATGTTGCGCAGCGCCACGGGCTCCATCAACGCGCTCAGTCCCTTGCCACCATTGGTCTCCGTCGTCTGCGCAGCATCCGTCTGCTCTGTCACGGCGCTA
GGGCGCTTGGGCGCCTCGGGCTCATCAAAGGACGACCAATTCTGCGAGTCTCCCATCCGTGTCAACTTGTGGTGCTCGCCAAGTATGCAGGTCAGGAGAG
GACACCGTTTCTATGCAACATTCATCAcaaataccggtatttgATCCTCACTAAATCGGGACTAAAATTCGAGTATCACCTCTCAAATCCTCTGATACCG
TGATGATGCCCTTGGCGTCGCCTCCGCGCACGGCGTCTGCGGCTTCGTACCGCGCGCTGCCGTCCTCGCACCACATGTACCAAGCCGTGGCTGACTTCAC
CCCACTGTCCCGCAAtcggcagcgccgccatcgccTCGAAGAAGAGTTCGCGCCGCTTCCGTACCGTTCCCGACGTCGCGTGAGTGTTGTGCGTCACCCT
CGCGGCTGCAACCTGGTGCGGCCGTGCACTTTGGCCAGTCAGATCACGCGCATGATGCTCTTCAACGGGTGCAGCGCCGTTCTGAGTGCAATTGCAGCTC
TGGCGGTGTGGACGGGGACAGCCTTGACAGTCGTGACGATGCCCCTCTGCGGCAGCGGAGTCGCCGTCTTTAAGCAGTTACTACACAGCGTCTTCTACTT
GTGCTGCACGGATGTCTTCATCTACAATGCCTTGGCTGCGTCGGCAGCAGATTGCATCGATATGGACTTAGCGGAGTGGGGGGTTACAAATACTATTAGT
GAACTGCACCCTCTGCTGCCGATTCGAGTACCTCCACCGCTTGGAGGAGACCAGCAGATTTTCGAGCCGTGTCCGCGGTTTGAGAGGTCGTTGggcacga
cgtcgccgagATCGGTGCTTGCCGCGGTGTATTTTGGATGTTTCAAGTTGTTGGTGGGTGCTGGTCAAATGCTGGCGGTTGTCTTGGTGCTGGGCGTGCT
TGGATTCTTGATTGGCGATAAGCGTGTCCCGATCCATTTGGACGCTCTGACAGCGCAACATCCGTTTGCGGTGTACACGACGGCGTTtggattgctgctg
ctggcattgACACTGCTGCATGGAATGACAAGGATGGCCAAGGTTGCTACGcgtttcttctgctgcgagACGGTGCGTTGAACACGAAGGACTGGCGGAC
GATGGGACGAGGTTCATCGAGGAAGCGATCGTTACGACTAACGGGCACACCAAGAAGGCATTTGAAAGAGAGGGACGACTTGGGTGCCATGCCATCAGCT
GCCAGGCTTCAAACACGGGGGAAGCCATCAAAGACGacagcttcgtgctgcagcaagaaagCAAACCGGGCAGTTCGCACTCGTGTACTGGAGCTCTCTA
GCTGCAAGCATCGCATCTGCTACCCGTGCCTTTCGAAGACGTGCTCGGACGCTCTCAAGCGCACCACTCCTGCGACGTGTTGGAAGTGCAACAAGGAAAT
CGCTCTGGACCAAGTGGAGCTTGTGCTGAGCCGCTCAGAATTTGTGTCGTACATGGCGTGGCGCCGCAACGAGATGAACCCGCGTGCTGACTGCGCCAGC
TGCGCCGT