Description :
From Genome Similarity Track
Location :
Scaffold_1219:797- 4928
Sequence
4131 bases(100 bases per row)
CCGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAACGAACCCACTGAAGTGGATCGTCTGCGTCAGAAGATCTGGGAAAGCCGCCATCT
GCTGATCGGTAAGGGTAATGCGTTACCGCCCGCCGCCCGCGGAGTCAAATGTGACATCAATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAG
GTGGCACCTCATTTCCGAGAAAAACTGTCAGATCTGATTAAGGGCCTGCTGCAAGCCAGGATCATCAGCTTCTCAACGTCCCCGTGGGCGTCGCCGGTGG
TAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACAGCCTGACTCGATTGATGGTGTATCCGATGCCTCTGAT
CAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTATTCTCTAGACATGGCCAGTGGTTTCTGGGTGGTTACTATGACGGATCGAGCTCGCGCA
ATATCCGCATTCATCACACCGTTTGGCCTGTTCGAGTGGACCCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCTCATCGATAACG
CCCTCTATGGGTTCACCCGAATACCGGAGTCCGAAACAGGTGGGTCTGGGGAAGGTGACGCAGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGGGATCC
TGAGACCCCATCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTGATCCCGGCGGAATCGTGGGATCAGTTGTGCGAGAGAGTGACGTCCTTACTG
GAGGCGTGTACTAAGTGGAATCTCTCTATTAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGAGTACTTAGGCCATCGAGTTTCCAAGGAGGGAT
TGGAGGCGAATCCTAAGGATCTGTCTTCATTAGCCGTTTTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCTTTCTTGGGCAGTTTGAACTACTACAG
TCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTACGAATTGAGAGAGGTAGATTTTGCCGCGATGACCACTCCAGCTGTCCAGATGAAAATC
CAACAAGCTCTGGCCCAGGAGATGCCGGATCCACGAAGGGATCCAAGTGGTAGGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCCGGGACC
AACAGAGAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGTTCCGAGCTCAACACGCATTCGTGGAGCTGAG
GAACAGGATCGCGACCACGCCTATCCTCCGTCATTTCGATCCGAAACGTCAACCTACGGTAATAGTTTATGCCAGTGACTGGGCAGTCTCAGCATCTCTG
GTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCG
CGCTCCTGCGCGTGTTGGATCTCAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACTCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGC
CGGGTTGCAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTAGACACTGGAGATTGTAAAATGTTCGAAAGGGGAAGACGAGGTCCTGGGAGTC
TTGGCCGCGAGCATCACACCTAGAGCTAAGATGGATGAAGCGCTGGCTACGATCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGA
CGGTACAAGTGGGTGAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGAGGAGCATACAGCGCAATACTGTGGAGACTGCC
CGGATGGGAAGTTGTACGGGCCAGATCCACTTATGCGGAGGGCCTCACCGTCAATGAAGCAGAGTATAACGGGCTCCTGCTGGGTTTGGATCTACTAAAG
GGACATGATACACAAAGGCTGGTGATTTGTGGGGATTCAAACCTTGGTGATTCGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTG
TTACCGCAGAAAGTGATGGTTCACCTGCGTGGGTGGATGAATCACGAGTTTGGTGCATGTTCAAGCGAGATTGGGAATGCCAGTGCAGATAGCTCTGGCC
AGTGCCGCTTTACCGAAATCTATGTGGTGTCGAAGTGGAGAGAGAGGCCGAGCATCATGATCTCGTTACGTTGAACCGACTAGACGAAGTGTGGTGGTTT
GGATCCGTAAAAAAGACAGTCCAGGTAATGGCTGTCACTAGGACCAGAGAAGGATTGGATCCAGCCCCCAGATTCTCGATGAAACATTTGTGAAGGGAGT
CCGCATTGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCTTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAGGAT
TCCAAATCCTACAGTATGGTTGCTACGGATTATGCAGTGGATCTGAATGACTTGCTCTTCTATTGTCCTCCTACGAAGAGAGTCAACGAGGATCGGGATG
GATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACATCACTACCACGCTAGTTTAGAAGGTGGACATCAGGGAATTGGTCGGACCTA
CCAACGGATCCGAGAATGTTTCCACTGGAGGGGACTATCTAAGAGCGTGCAACGGTGTGGCGGTGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCC
ACGATCGAAGGGGAGTCGCCTGGGAATGTCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCACATCCCCTCGTTGCCCAAGTCGTTCAAAGGAA
ACACAGAATTGTTGATCTGGGTGGATCTGTTTACCGGATACGTGATAGCCAAAGCTAGTGCGTCTGGAACTGCACAAACCATTGCCGAATCGTACGAGGA
GTGCGTTTTCCGAAGATTTGGGGCTAGTGAGATGATTAGGCACAATCGGGAGCCAGGCTTTATGTCTGATTTCTTCTGATTTCTTTCGAGCTTTTAACCG
GATCCTGGGGCAGAGACAGCGGCAACCATGGCATATCGCCCCCAAGCTAACGGATCGGCCGAGCGCATGGTACAGACGATCACGAGGGCACTCAAGATGT
ATGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGACTCCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGACACCCCATT
TTACTTGGTACATGGGTGGGATCCTAAATCCACCCTAGAAGCGGCCATTCCGGTATGTAGCATTAAGAAGAGAAACCGAGATCCAAGACAATGGCGATAC
CAAGTCCAGAAATACTACCGGCAAGCCAGATCCCAAGTGAACGAACGGCTGCGGAGTGCGATACAAGATCGAGCAGATCGACACAACGAAGACGCCCGTC
CACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTAGATCGGGTGAAGGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCACGGACCGTTCCG
GGTGAGCGAAAAGATAGGGGAACATGCGGTGAAGTTGGAAACGGCAGGTACCGAATATCGCTTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTC
AAGGAATATCCGGACCGGCCGCAAACCCGTCTTTCGGTGGATGAATCCAACCGGGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGGATGTGG
ATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCAGGGAAGCGAACTAGATACGGACGGATTTACCGCGAATTTCTGGTGTACTG
GAGTGGATATGGCGAACCCAGCTGGGTAGCCGAGACAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGCGGGATCGTACGAATCGGAACAGATTC
GGCGTGATGCGGTCTCATGAAGGCGAGTAGGAAGGGGATCTAGGGATGTGAGTTGGTCATGTCGATGGGAGGACGAAGAAGGACCCACAGGAAGGGTGTG
GGCCGGGAGGAGGAGGATCGCTGATGTGAGT