Description :
From Genome Similarity Track
Location :
Scaffold_386:7969- 10814
Sequence
2845 bases(100 bases per row)
TCCAGATCTCTCAATAATGCCAACACCTCCTTCTCCGCAATGTGGTAGCGCAGCTCGAACTCGTTCAATATGCGTCCAGTGAATCGCACAGGCTGAATCA
CTCCATCATACATCTGACCCAAAACTGCGCAAGCAGCCCATGGATTAGCATGTGGAATGATGACGAATTGCTTCGTGCGGTCCGGGTGACGCAGCAACGG
GGTTGAGACAATCTTGCGTTTCAGGATCTCAAACGCCTCTTTTGCGCGCTCAAGGTTAATGCCTGAACGTACTTGCTCCTCGGTCAACTCATAGAGCGAG
GCGACCACCACTGGGAGGTCCTCGATGAACTTGTTGTAGTAGTTCAAGCTCCCTAAGAAAGTTTGGACCCTTTTGAGCGTAGACGGAAACGGCAAGTCTT
GAACGGACTTTGCAATCTTGGGTGTAGCTCGGATTCCTTCAGCGCTGATTTCATGGGAGAGGTATGGAATGGTCAGCTTGCCAAACTCACTCTTTGGGAG
GCTCACGGAAATATTCCAATACCGAAACCTGAACAAAAGTGCGTTCAAGTCACCACATAGCTGGTCCCAAGTCGGAGCACCACGAGCAATATCGTCGATG
TAGGAACTGCGTCCAAGCACTGGACCCATCTGCGAGGGGGCCAGGATGTTACGCTGAAACACCGTCATCTCATCGGTCAAAACGGGGACCACAGGCAAAC
TGCGTTCAGAGTCTTCAGCGCATGTGCGTTCAGGGTCTTGACCGCGTGTGCGGTCAGTGTCAGGTCCATCCTGTTTCAGGAATTCCAGTACATCACGGTC
GACGAGAGCCTCTTCCTCGGGTGGCAGACGCACGAATCCCCACAGGCAGTTGTTGATCACAGCCTGGTAGATGAGGGGCGCGTTCTTGAGTCCAAACGGC
ATCCTGATCCACTGGAAGTGCCCAAACGAGCAAATAAACGCCGAGATCAGCTTTGCGCGTTCAGTCATCAACACCGCCCAGAAGCCACTAGCCATGTCCA
GACTCATAAACCACATCGCCGACTCAAACCCAATCAAAAGATCGTCGATCAGGGGAAGAGGGTACCGCGACAGCTTGATAAACTCGTTCACCACGCGGTA
GTCAATACACATCCTGATATCGACTCCGTTCTTCTTGAGTACGATGACGATCGGCGAAGCCCATTCCGATTCAGAGTGCTCAATCAGTCCCGTTTCAACG
AGTTTCTTGAGCAACTCATAAACCTTGACCAGCAAATGTGGAGCAATCTGTCGCGCACGCTGATCCACTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTC