Description :
From Genome Similarity Track
Location :
Scaffold_50:79674- 81900
Transcript NameFunction/comments
Physo_136988hypothetical protein

Sequence
2226 bases(100 bases per row)
ACCTTAATCTCTTGGCGCTACCAGTCAACACCCTACAAGCTATGCCTCTCGGGTGCTGACAGCAGACATAATCCGGCCCGTGCAGGGGCTTACTGGAAGC
GCGTGCACGTGTTGTGGACCTAGAAAATTCTGCGCTGTTGTTTGTTATCTCTGTCGGGCGCCCTGAAGGGGCGCCTCCACTATTCCTAAGCTCCTATACA
AATACCAAATGAAAGTGGGCGGTTTTGGATCTCGGCCGACTCTTCACCGAGCTCGGCGACGCTTGAGCTCGGCTAAGCCGGATAACCTGTCCGGATAACC
CCTTGAACTCGGCTGAGCCCGATACGGCGTGTCCGGATAACCTGGCGAACTCGGCTGAGCCGAATAAGATGTCCGGATAACCCAGTGAACTCGGCGGAGC
CGGATAAGGTGTCCAGATAACACGGCGAACTCGTCGGAGCGACCCTTGGACTCGACTGGGCGACTCCCGGACTCAATTGGACCCGGTTATCGTATCTGGA
TGGTACGTGGTGCCGTTTAGCCGAGCTCGGCGGCTTGAACTCCCCATGACCTCGGCTGAGCGTGTCCAGTGCCTTCCTGAACTCGGCTGGGTCTTCATCA
CTGGGCCTACCACGTGTCACCAGGTCGGGGCCGGTGTGCCTTGAGTTTCTGACACCATCAGCCGAGTTCAGCGGTCCATCAGCCCACTGAGCTCGGCGGA
CGGTCATCCCGCCGAGTAGAACTTGGCTCCTGGTACGTTGTTCCACTGCGGCCTTGGAGTGTGACACAAAACTTGATGTTCCCTACACCACAGTTACAAG
TGCTGAGCGGAGCGCACAACCCGACCGAAATTCTTCGAGTGTTCACGTCGTCGCTCATCAAAGGCTACATGGGCGACGGCTTGATCAAGGACAGTCCGTT
GGTGCAGGACGTACTGGGAGGTGACACCACGCCCCGTGACAACGTCCTATACCTCGAGACTGCTGAGCAGACTTCCACTGAGGGTTGCTCCGCGTTGCCA
CTTTTCAACTCGGCGATGTACGGGTACGACTTCCTGAACCCTGCGTACCTGGACATGGTCTCCGACACCAAGTACACTATCACCGCCCTCGAGGAGTTCG
AGCTCGTGGTCACTATCGTCGACTGTTCCTTCAGCCAGATCAAGTCAGGCGATACGTCTCAAGCCCGAGTCTACAACTTCGTACGCTCGCGTTTCGACTC
GACCGACCTGCACTTGATCACAGTGTCGCTCTCAGTGCAAGAGTACGAAGTACGCGCGCACAATAAGCAGGGTCCCGCGTTGCTGGGCATGCTCACCGTC
ATCGACGACATGCAAGACACCAACGTGACGCAGTACTACATGGCAGCGCTCACGTACCCGTACCAGCGGACCGCAAACTTCGAGATGTACGAACTTGTGG
GCGTCACGGATGAGAGCTACTTGTCTCTAACGAGCATTCCCCAGAACCCCGAGACGGAGCCGGTCAAGCACCTGCTGACAGCTCGGAAGCGCGGGTTCTA
CAACGGCGACACGCAGTGCAATGTTCGCACGATGTACTCGCTACTTGACGGGGTAAGTGCCACCAAGGCTTTGACTCGCTGGGAATGGATCGGAGAAGCC
GTCATGGTCGACTCCTGGACCTGGGTGCACTGTTTTCACTTCTTTTTCGGACTGCAGATGACCTACTCGTTGGTGGTCTTGTTCCTCGTAATGTACCAGA
AGATTCGGTCGGGCAAGATCTGGATCGGGGACCCATTCGCCTACACCTCAACGACGACTCTCGTCATGCGCGGCATTTTGGTGTTCTTCTCTTGGATTAT
CGACTCCTTCTGGCCCGTCAACGAGTTCGCCATGTCGAGGGCTGCAACGCTTGCCAGCGCTCAAACGATCTGCGTCCACCCGGAAATGATGCACGCAGAC
CTGCTGGTTGTGTACTTTTGCTTGGCGAGTTTTCTGAGCTCCGTGTTCCAAGAGCGAATCGACCTGTCAGGGGCCATCTTTTTGTTCGAAGTCGTGTACG
AGCACCGGCAGGCGCTGATCCAGGCTTCTTCAGCCGTGGTCAACGAAATCACAACCACCTTCAGTGTCCAGTACAAAGTCGGCATCGCAAAGCCAATTCC
AGTCATTACCGACATGTCCCCACTGCGGCTGTGGTCGTCGTTCGAGTTCCCCGAAAAGGACGCCAAGTTCCTCGCCGCGTCCTTCACGCCCATGCTCTTC
CTCATGTGCTCCATCACAGTGTTTGC