Description :
From Genome Similarity Track
Location :
Scaffold_426:7967- 10194
Sequence
2227 bases(100 bases per row)
TCTCTCGCATGGTTGATCGATAAGGTGGCTTCCGTCNNNNNNNNNNAACGCCCTCCGGAACCATAAGGTCCATACCCAATATGGATTCTTGTCCGACTTG
ATCACCGACCCAAATGTCGAAATAATACACCAACCATCCGTCCAAGGTAATCTTTATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCTTCGTCCTCCCACCGTCATATATGACTTTACCATGCACTCTTGTGTTTGACGTTCGTCGATCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNAATCGTGGCTTTCTCTTAGTTGATCTTTCCCGCCGCTTTTGTTTGCTTAAACCATTTTNNNNNNNNNNTCCTCACAGGCGAT
CGGGCATAATCATTCACTCTTTTCACACCTGGTATTGACCAGACCATTGTAGAATCTTTTTATATATCAGCGATCGGATCAATCCGATCGTTAATNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGGCTCC
ATCGTTAAAGGCGATCAGGCGAAAAAAATTCACTCTTTTCACACTTTTAATGACGAGACCAATGAAAAATCATTATGTATATCAGCGATTGGATCGATCC
GATNNNNNNNNNNTTATTTCATGGGGCATTTCCCGCTGTCGTGTATTTGTCCGCATGCTGCACACACAAAGANNNNNNNNNNTGCATAAATGGATAGCCT
AGAACGCTCGACTCGTGCCAGATTCCAACTTGGATAGCGTCCTAGCTTAACATCTCTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
GGGGGAAACATTCTAGCATGCTTCGTGGGCACGTACACCTTTTGAATCAAAGTGAAAAATTCACGCATGGGGCATTAGCCATTCTCGTGTATTTCTCCGC
ATGCTGCACACATAAAGAAACATTTTTCAGAGAGATGTCCTTTGCGACCACACATCTGGCACGTCAATCTCTTCCGGCACCCTCGATTACCGTGTCCGGG
AGATCCACAACGGGTACACGCCTTCGATCTTCCACCACGAGCGTGTCCATCCCTGNNNNNNNNNNGGAAACATTTCAGCATGCTTCGTGGACACGTACCA
CTTTCGGATCAAATTGAAAAAAAATTCTATGGGCATTTGCTACTCTCGTGTGTCTGTCCACATACTGCACACATGAAGAAACATTTTTGTCAGAAGGATG
TTCTTTGCGACCACACCTCTGGCACGTCAATCTCTTCCGNNNNNNNNNNTCCGATTACGATTCGCTGCTTTCAAATTTCTTGCAGATCACTCGCACCGCC
CGAGCTGTCCTCTACGACATCGGATTCGAAGACGTGGGCGTTCGCTGATGGAATNNNNNNNNNNACGCAAACTCGACGATGATCCATGTCTTCATCGGAT
CCAATTGACTCCGATTCCAATCCACTGCTTCCGACTTTCTTGCGGATCGCTCGCACCGCCCAAGCTGTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCGATCTCATCGACGCTTTCATCTGGATATTTTCTAGTCGTTGGCACTCACGTAGATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCGGATTCGAAAAGCGGTCGTTGGCTGATGAAATTCGCTCGATCCCATC
GGCACTTTCATCTGGCGATTCTNNNNNNNNNNNNNTAGATTCTTCTCCAACTCGTCAACATCCATCAAATGTCGTATTATCAGCTGTTTTGCTAGATCAC
GATCGCAATCTTGTCGTGCTTGGCTGCGACATTAAGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGAAACAATTTAGCAATCGCTTCCATTTGTGCCACGTAGATCGACTCATTTGGT
CGTACCAGTTTCGTGCTGGTCCTATCAACGGATTGCCGAACATCAAACACTTTTCTTTGTCAGGCACTTTATCGTGCAGGAACGCCGACTTGACTTTGCT
GATCCAGATCCTGGCCTTATCTTCATC