Description :
From Genome Similarity Track
Location :
Scaffold_1067:7967- 9306
Transcript NameFunction/comments
g17868.t1POM71256.1 Pol protein [Phytophthora palmivora var. palmivora

Sequence
1339 bases(100 bases per row)
TGTAACGGGGTTACACGTACCCGTTAGTGTATCGTACACGAATAGTGTGTTTCACACAAATGGTGTGCACACCCAAGTTGGTGTGTGTACACGAGACTTA
GGTTGGTGGCCTCACAGCCACCCGTCATGCATATTACTAGGCTCTACTATGGTAGATAGTGAGTGTTATACATTTACCCCACTGGCGGCCTTGCCGCGAA
TAACAACAATAAAAATCAGTTCACGTTTTGAAGTCTAGTGTCTATTGGCCTTATTTAAGGTATTAATAACTCTAGGAGTCTGTAGATCGCATATCTACAG
ACTGTACTTGGTTCTGGTATAGAACCAAGGTTTACAACCGAACTAAGACTCTGAGAGTCTACGTCTTCCTCTGACGCAAGCTACGGCAGCCCCGCTGCAC
TTGGTAGCACTCGTAGTCAATCCTACACCTGAGTCTTACGACTGTCCCTCTGTGAGGATGGAGCAATTTGCCCACTTACCCCCAAACCAACAGGACGGGC
TTAAAAAGCTGATGTCCTTGTTGGGCCCGGAAGGTGTGGCTCATCTTGCTTCGCAAGGCCCCGACGCGATTAATGCGCGTCTGGAGGCGTTCTCGAGTTA
TGAGAATGCTCTGTTGGAACATCTACAACAGAAGATGACGGCTGTGACAGCGTCTACAACGCCCAAGCCGGCATCGGATGGAGCTCCACGAGCTAAGCCG
CTCATGGTGAGCGTGAAGACCTTTGAGGGCAAGGAAGGAGAGAATCTCCTGCTCTGGATTAGAGAGGTCGAGATGGCCATGGCGTCCGCCATACTCCAGA
CGGAGCAACAACGCGTGGCGCTGGCCGTGTCCAAGCTTGGTGGCCGGGCCCGGGAGTGGGCCCTAACGTGTGGCACGTCGGTGGACAGCGCGTTCCCATC
CTGGGAGCAGCTGAAGCTTCAGCTGTCGCGAGTGTTCTCGCCGCCTAACCAGGCCTATCGCGTGCGATCACGCTTCCTGGCTACCCGCCAAGGAAAGAAG
GAATTGGTGGACTTCGTCCAAGAGTTACGAACTCTTATTGCCGGTATGGCTGCGGACCCTCTTCCGGAGGCGGTCACGGTGACCATTTTCATGGAAGGCC
TCCGCACTGGCGTGGCCAGAACGGAAGTATTCCGAGTTCACCCCACCTCTTTTGAAGAGGCAGTGAGCGTGGTGTTGAACGCCGAGTTCAACTTTAAGTC
GGCCCGAGCCGGGTGGGGAACGTCGCAGACGAACTCATCCGGAGCCGCCGGCTCCTCGGGTGGGCCCGAGCCGATGGACCTCAGCCATGCTGAAGACGAA
GAAGCTGAGCTTCTTGCTGCCGAGCAGCGCATCGGCATC