Description :
From Genome Similarity Track
Location :
Scaffold_28:79641- 81693
Transcript NameFunction/comments
g8824.t1hypothetical protein

Sequence
2052 bases(100 bases per row)
CTCGTGCAGGGTGACGAAGTGTGCATCGAGTACCAGCTCGACGCGTCCGTAGCCAGCGACGCAACGTGGTTCGGCGTGGGGCCGTCGCGCGACTCCAACA
TGGTCAGCAGCCCGGCCACCAACGTCATGATGTTCTTCAAGGACGCAGGTGTGCCCACGTCCTACCTGCTGGGCGGCTACGTCAACAGCGACGTGACCGC
CGGGAGCGACCAGTCCGCCTTCGTGGTGGGCGAGACCAGCACCACCAGTATGAGCTTCAGCTACCAGCGCACGCTGGCGGCCGCCACCACGTCCGAGGTG
GCGCTCTCGGCCTCGGGCGCGACCGACTTCATTTGGGCCTACGGCACCTCGTGGCCCATTTCCACGCACCGGAGCGGCACCAACGGCGCCGCCACCTTCA
ACGTCGCCGCGGCGTCCGCGGGCTCGTCGGCCGGAGCTACCAGCACTACAGTCGGCTCCAGCACGTCCACGCCCTGGTGCGACGACAAGAACTGCCCGGG
TATCGTCGGCGGCATCGCCTTCGCTGTCATGGCCGTGTGCGGCCTGCTGCTCACGGCGGCGCTCAAGACCTCGCCCGTCGGCAAGCTGCTACTGCACCGC
ACGGTGGCCCCGCCCCCGGTGAAGCTCACGACCAACGCACCTGTAGCCAAGCCCCATACGATGTTCATGCAGACGCTGGCGGACCTCCATCTCGGAGAGC
TGCTGGTTATGCTCATCTTCGTCGCTGCGGTGGTCGTGCTCATCGCGCTGCTGAGCGACGAGGACAACTACGTGGTGTCGGGCCAGGTGAGCCTGCTTAT
CCTCATGTTCCTCATTCTGCCCGTGTCGCGCCTGCCCGTGTGGTCGGTGCTCTTCGGCAGCTCCTTCGAGCGCATCGTCAAGTTCCACCGCTGGCTGGGT
GTCATCATGAACGTCGCGGTGATTGTCCACGTCGTGCAGGCCAGCAAGGTTGTCGACCTCACGCTCAACGAGAAGTACCGCGACGTGACCCCTCTGCCGG
GTTTCATCGCCTTCATCTGCTTCATCGTGATGATGTTCATGTCGATTGAGTACATCCGTCGCATGTTCTTCGAGGTCTTCTACTTCACGCACCGCGTGCT
GTCGATTGTCGGCTTCGTGTTCACCATCCTGCACGCCCCCAAATTCATCGGCCTGGCGCTGTGTGTCCCGCTTGGATTGTACGCTCTTGGTCTGCTGTAC
CGTTGGTCTAGCGCCTTCACGGGCTCGTACAAGACCTCTGCTTCGGTGCACTCCGGATCGAACTCCACCGCGCTCGTCCTCGAGCCGACTCCGAAGACTG
GCAAGATGGCGATGAACGTGAACCCTGGCTCGTACTTCCTGGTGCGCCTGCCGGCTATCTCCGCAACCCAGTGGCACCCGTTCTCGTCCATCGTAACCCC
GGACGGCAAGTCGCTTGGTTTCTGCATCAAGGCTATGGGCAACGGCTCCTTCACGCGCAAGCTTATGGAGAAGGCCGGCACGCAATACGAGCTCACAGCT
AACCTGTGTGGCCCCTTCGGTAAGATGTCGCTCAACGTGGATCGCTATGATGCGGTGGTGCTTGTCGCCGGTGGTGTGGGCATCACCCCGATGATGAGCC
TCATCAACCAGACACGCTTGTTCCCGAATGCCGCCAGCGACTCGGACAAGACCCCCAAGGCAGCGGACTGGTACGTGATATGGTCTGTTCGCGAACCGGA
GGACATCCTGATGATGGAGCAGTTCCTGCCGACGCACGCTCAGCTCGACTACGCCGCTCGTGCCAGCATCCAGGACCCCAACATGGCCATTCTTGGCAAC
AACGCGCCGGCACCTGTCAACATCAACTGGATGTTCCACGTCTCGAATGCTCGTAGTGACGGCGTGGTTACCCGTGCCAACGGCGAGACGTTGTCCTACC
GCGGTGGCCAGCCGGTTCTTGACGAGGTGATCAACACAAGTCGCTTCAACGGCCGCAAGGTGACTGTGGTGGCCTGCGGGCCGCCCACCATGACCGTGGA
GGCTCAGTCGCTCGCGCGCAACTGCAACTTCGACTTCCACAAAGAGGTCTTC