Description :
From Genome Similarity Track
Location :
contig_22:796223- 797641
Transcript NameFunction/comments
g4873.t1hypothetical protein PHYSODRAFT_336177

Sequence
1418 bases(100 bases per row)
GCGGAGGTGCGCGCGCACGTTCAGCCCACCTACATCCTGTACACTAGCGCCTTGCTCGCTTTCGTGCTGCCCCTGCAGTTCGGTTGGTCGACCTCGCAGC
TCAACTGCGCAAGTTTAACAACGTTGAGGATTGCAACGCCCGTCCGGTTGCCGAAGACACGTGCATCATGTTTCCAGGACACACCAAGTTCCAGTGGACT
ATCGTCGTGAACGCGTGGATTGTTGGAGGTATGATCGGTGCTGGTCTCGTCGGCAAGTTCGCCGACAAATTCGGTCGCAAGCAGGTCCTCATCTACAACT
GTGGCTTCATTGTTGCTGGAGCCATTGTTCAGGCTGTCGTGTCGAACCTGTGGGTATTCGCAGTCGGCCGTCTGCTTGCTGGTATCGCGTCAGGCGCTAC
GACGGGCAACGTTGGCGGCTACATCAACGAGATCTCCCCGCCCCACAAGCGTTCGCTACTTGGTGCCGTTCTCCACAGTGGTATCACTGTCGGTATTCTG
TTGGTTGCTACAACTCATTTCTACATGGACTTCGACAACGGTTGGCGCTACATTGCTGCCTTCCCGATCGTGCTTGCGGCTATTTTCCTGAGCATGTCCC
CGTTCTGATGGTGGAGTCGCCCGTGTGGCTCCTGCTGAAGGGCCGTCGCGCGGAAGCCGAAGCTGTACTAACGCGTCTGTTTGGCGCCGAGAACGTGCCT
GTGGCTCTCGAGTGGATCGAGTCGAAGCGCAAGCACGACATGGAGATGCAGTCGAGCACGTGGAGCGAGACGGGCAACGAGGTTGTTCGCAGTGGAAAGG
GTATGCCTTTTTCGGAGCTGATCGCTCCCCCTCTTCGTCGCCAGTTCATCATTGCCTTCGGCGTAGCCGTCATGCAAAAGATCACGGGTATCAACACGGT
GTTCTACTACTCGTCGGATCTGTTTAACCAGGCTGGTCTGAGCAACGCTCGCGTAAGCGCTGTCATTATCGACATCGTGAACATGCTGCCGACGCTGGTG
TCGGGCTTCTTCGCGGCACGTTTCGGAAACCGCCGTATGCTGCTGTGTGGTCTTGCTGGCATGTTCGTGAGTGCCATCGGTGTGACGCTTTCACTGTCGT
TCAGCTGGTCGGCATTGTCGATTCTGTTCATTGCCACGTATGTGGGTTCGTTCGGCGTGAGTCTCGGGCCGCTCATGTATGTGGTCATCGCGGATATCTT
CCCCGACTACGCTCGTGCTACCGTGACCTCAATTTGTGTGCTTACGGCCTGGTCCGCTAACCTGATCGTGGGCGTTGGATACCCGTACATTTCGAGCGCG
CTGGACGACCTCGCGTACCTTCCGTTCGTAGTGCTGCTGGCGATTTCGTTCGTGTTCGTGCTCATCCTGCTCCCGGAGACGTCTGGCAAGACGAACGAGG
AGATCCAGGACGAGTTCC