Description :
From Genome Similarity Track
Location :
Scaffold_97:79602- 81123
Sequence
1521 bases(100 bases per row)
GTTAGCGGCTTGGCCCACGATGTTCTGCACGGTTTGAAGGCCTTGAGAAGTCGACAGACTGGGTCGCATCCTCGAAGGTAGACTCCCAGTCTGACCTTCT
TCTTCTCGGATGGTGGCGCTCACATCTTCTCCGGTGTTAGAAGACATCATCTCGTCCTTCCTTCTTACGTTCTCCGCGAGTCTTCACTTGAAACACGACC
TTCTCCAGCAGGCAGACTACCCTGCTTCTCCACCAGATGTCGTATACCTCCTCTTCCCTCAAGGGTCGGGTAGTCCGCGGCTGTTCAGGGAGTACGGTCT
TGTTTAGTGGCTGCAGGAACGGTAGATAGGAACACTTGTAAGATGACATAGAAGTTTGGTTACTGGCTTGGCTTCCTCTTGAGGAGAAGGAGGGAAATAT
AAGACTGTGAGCTAACTGGAAGAGAGGTCTAACACCTTCTCGACCTTACATACACTGCACTATCTCTCTTATACTAAAAAGAAGAACTCACTTCGTTTGT
CGTCAGTCCTCGTGGGACAACGGGGAGCTCTGGGAAGGGGCTTGATGACGCGAGGTGCTTTGTTCCCACGACGCCAGGACACCGGCGTTCTGAGACCACC
TTATAGGACCACCCTAACGGGCTTGGTCAGGGGCACGTGGGTCGTCGGGCTCAACGGGAACCACCCTGCCGGGACGGCCGGGCGAGAAGTAGCTACCGGG
CCTCGAGTCATCCCGTCGGGAGGCAGAGCTCCTGGAATGACCCCTCCGTTCCCGGGTACGGGACATTGAGGAATATTGATATTCATTAACGTATCAACCC
TTGAGGACGCACTGATAGCATCACTGATTATCATGACTCTACCACTAGTTGTCGTGACACCAGCACCGCTCGCAACCAACGACACGCCATTTGATGCCGA
CATAGTACATCCACAGAACTTCACGAGTGTAATCAGTAAAGTCTCGTAGTATTGGGCTCAGAACCTAGCACAATGCGCAATCAAGTGGCGTCACTTAGTA
GATAGGAGACTAACCGAAATAAACGCTTTCTTTCCCACTGAGCAAAAATGGGATTAAGGGGGAACCTCGAAGGTGCCAACCCCCTTCTCGTTAACCAGAG
AACTCCCATAGGCGGATGTTGCTCCAATATACGATACCACCGATGGTGGGTGGTACAGTACATGAAGGCTACATGATTTAAAGAAGGGAATAGCTGAATA
CTAATAGGATTCCTATCGAGGCCGTCTCGCGTCAAGACAGCAAGGTCGGACGACAACGCACGTTAGACCGCGGCTTTTTCATTTTGGCTAAACTGTATCC
TCATACACATCAACCTTAAGACGTAACGCGTAAGTAAGCCCCCCTCCCTCTCACACACACACTCACACACACACACACACACACACACATCACACACATC
AGAGGAAGAAAACGAATTACCACGTCGGGTATTTCAAAGGGAGGACTGACAGTAGAGAAAATGATTCTTGCTCCGCTTCGTCATCCGACTCGCAGGATTC
CTCAGCGTTCATCTTTATATG