Description :
From Genome Similarity Track
Location :
Scaffold_2513:796- 4195
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2513-fgenesh-gene-0.0Conserved gene of unknown function
Pytiw_DAOMBR242034snap_masked-piw_contig_2513-abinit-gene-0.6Novel protein

Sequence
3399 bases(100 bases per row)
ACACACTGTGTCTCTTTTGATATATTTTTAAAATAATAATTAGAAACTGGTGGCGGCGCTGCGCACGGCCGCGGCGGCCATGAACCACGTGGCGCCGCGC
ATCTCGTCCGAGGAGAGCGCGTCGACCGCATTCACCAAATCCTCGACCGAGTTCCTGCAGCTCATCAAGGAGATCCACACGGAGCTCGCGGGCCACATCC
ACTTGGTCTCGGACTACCGCACGTACGGCCGCAGCACGTACGGCGCCGAGAAGGACTTTGCGCTCAGTCGCGACAAGGTCGCCGTCGTCTCCGAGCAGCT
CCAGAGCCTCTCGCGGTACCTCGAGGAGCACTTTGAGCCCGAGGACAACTGATTGATGCAGCTCATCTCGTTTTTTCTACTAATATAGGCATTTCTCACT
CTATGGAGCTCTTCTTCATGGTGGCTGTCCCGTTTAAGCGGATGCGTCCAAGCGGAACGCTGCAAAGTGGCGCTGCAGCGTCGCGCGCATTTGGACCTCG
CGCGCCTGGTCCATGTCGTCGCAGAACAAGTCGCGCTCGTCGCTCACTGGGTCGAAATGCGCCGGCACCTGCAGCTCTGGCACAAAGTCCCGCATGGTCG
CCTCGACCTCGCTCTCCAGTTCGCTCAGCTCGCTGTCAACAATGTCGTAGTCTTCATCCTGCTGATACTGAGGGTGACTGGAAATGGGCTTCCGCCAGCC
ATTCTGGTAGAACTGGAGCGCCAGCAGCCGCTGATGGGTGTCGTCCTGCAACAGCGCGATCGCGAGATCCTCGGGCTGCTTTGGCGTCGCCCAGGTCTGC
AATTTTTCCACTGGGAGCGCGAAAAGCTGAGCCAAGTGCGCTGCTGCGACCTGCCAACAATTTCATAAAGTCATAGTGCTGATGAGTCACACAGTGTCCA
TGCTAGAGACACACATTTGCAGATCGTACCTTGCGGTAGTTGATGAAGACGTAGTGGATGGCGATCGCGGCGGCGTACCACTTAAGCGACTGTGGGCGTT
CAGCCACCAGTGCGAACGAGAGCGGTACCAGGACCTCGTATTGCTGAACCATAAGCGGCAGGATCGCCGGAGTGGACTTGAGGAGCGTGCTGATGGACTG
CGCCGCGTGCACAAACGGCGAGCGCAAGTGCGAAAACGTCTCGTACTCGCGGGAGAACTGCACCGGCGTGAATCGCTCCTCGAGTCTGTAATTATTTAAT
TAAATGCGATGAGGCAACCGGATTTTTCAAGAGCTATTGCAAACCTTGAGCACTCTTCCTGGAAGATCACGTACGGCTCGAGCGCCACGGCGGCATTCTT
GATCCACTCAATGAGCGCTTTGCAAATAACAGGCTTGCACACCAACACACAGCAGCCAGTCAGTTAGACTTGTGTAGCTATTCACAATGTCCAATGCCCT
TATAAACAGACCTGCAGGTGGGCGTTCTGCAGCAGCGAATGCACGAGTTCGAGCCCTTCGTGCTGCAATGGGATGTTGCTCGACTGCAGAATGCCCATGG
CCAGTGAGATGAGTTCGGTCTCCTTTGCACGGCGGTATGCCAGGTCCAAGTAGAAGGACTCGGGTGTGATAAGGCGCCGCAGGATCTAAGGAATCACAAT
TTCAATACACTTTAGCACACATGATAGATAACAGACTCTGTTGAGACCCCAGCGAGGACGTACCTGGGCGCCGAAGACCTGGAGCTCTTTCTCTTCTTCG
TGCTGGAGCATGAACATGATCGCCGAGTGGACCTGCTCGACGCTCTGTGGGTTCCCGACCAGTTGCTCCAGGAGCACGTCCCGACAGGCGTCCCACAACG
GTGTCCCTGCCATTGTCGTCGTCATCGCCTTCGCATCCCCACCACACTTTTCAATTCCCGTTAGTGCGCCGCGGATGACCGCGAGCTCCCCATGGTAGCG
ACTGATCTCCTCTTTGTGCACACGGCCTCGCTGGGCGATGCGCAGCAGCAGCTTCATGATGGCGATCCGATCCGCGTCGCTCACCAGAACAGCAGCTGGG
CTCTGTGGGTTTGGAATGCGCAGTACTCGAATGAGCAGTGTGAGTCCGTCAGCTTCTTGGAACTCGCGATAGTACACGTGCACGCTGGCCGACGTGAGGA
ATATCTGGACGCACGCAAGCTGCTCGCTGAGCGCAAAGCACTTGACATGGGTGACGGTCTTGTGCATCCACACGAGCACGCGCGTGAGGAAGAGCGACGC
GTCGGCGCCATACTCACTCTCTAGCAGTTCACAGGTTCCATTCGCATGGGAGGGCGCGAAGTGATCGCGGAACCACTCAAGCAGCTTCTTGCGGCGGCTC
TTGGAGGCTACGAGATACGAGAAATGGGTGGCTCTCAGGCTCAGATTCATAACAGTGTCTGCGCTCTATGGGTCCACAGAACGCACCTTTATCCCAGTCG
CGCAGCAAGGAACTCATATGCAGACAGACAGACAATGATGATTAGCCTTGAGCAGCAACACGAAACCTAAGCAGTCAGGTCACACATGGAGAAAATAGGT
TTTGACCTCGCGACTCTTTGCCACTCGACGATTTTCAATGAAAACCACCATTTTCAGTAAAAAGATTACCATTTTCACTGGTTCTTCTTCGGCATGTAGA
CGCCGCCGGCCCTCGAGACCCACGCCTGAGGCTCGGGTGTGTAGAACGGATCCAGCTGGCGCGCAGGACTGGGGCTTCGGTTTTCAAACGCGTCGTGGGT
CCACTGTTCGCGGTTGGGCGAGTCGCGATGCACTCGTCGTCTCGAATTGCGACTCGGAGACCTCGACGACGACCTGCCGCGCGGGCTGCGGTCTCGCCTG
TGGTGGCTATGACGTGTTCGGCTTCTGCTGCGGCTTCGACTGCTGTGCCGGTGACGTCGCTCACGGCTTCTCGAGCTACTGCGGCTTCGACTTCTTCGGT
GTTCGCGACGCCGACTGCCGCCACCATGAGCTCGCTCATGACGGTTCTCGTCAAGCTATTTAGTGACACATACAAAAGGCGTTAATACTCAAACGTAACA
TAACGAGACTGAGTAAGACGTACCTGAGGTCGATACGGATCAGCGGGCGGCGGCGTGCCCACCAGTCGCCCACGGGGCTCGCTCGGCGACCGACTCCTAC
TCCTCTTGTGCTTCTTCTTCTTCTTGCTCTTCTTGCTCTCTTTCTTGCTCTTCCGGTCGCTCTTGCGCTTCTCCACTGGTACGTCGCGACCAAACTCGTC
CTTGCGCATCAGCACCGTCTCTGCTGTCTTCTCCTTCTTCTTCTGTCGTGGCGGTGCATCAGCAGATGGAGAGGGCGACGACCTACTTGTTGTGACTGGG
GTCTCCTCGTAGCTCTTCGCTGGCGTGGGCGAAGCTCTTGGGGTTCCGTCTGTCGTCACGCCATCCTCCGCCTGTGGCGCGACGATCTCGCCCCTGCAG