Description :
From Genome Similarity Track
Location :
Scaffold_389:796- 4004
Transcript NameFunction/comments
Phyin_T30-4PITG_21446Putative uncharacterized protein

Sequence
3208 bases(100 bases per row)
CCAGTAGGTCGTCCAGCCAGATTAACAGACCGTTGTACAAGAAGTCTTGGAATATCACTTGGACTGTGGCTTGGCAGTAGGCCACGCTGTCTGAACCCCC
CATAAAGACGCGTGTCGGCGTAAAGATTTCCATGTCCGTAAGAAAAGAAAATAATTCCTGCCACTCGAGTGACAGCAGAAACTGCCAGTACCCCTTAAAG
AAATCCAGCAGAAAATAGAGCTCTGATTCATCCAGATAGTCCGTGATTACTTCCAGAATGGGCATTGAACAGAGATGCCTAATTGTCCGAGCATTTACGT
GACGAACGCTCACTGTCATGCGAAATTGACCCGGCTGCGCTTTCTTCACAATCAGAGGAGGGGAATATCACTTGCTGTGAGGATTGCGATAGCAAAGTCC
AGCATCAATGAGCTCTTGAACATGTTTATTCATAAACGCCCGGTGCTCTGGCGGATAGCGCCGGGCTTTACACCTCGATGGCACAGCGTCCGGTTTCAGA
GTCACTTTCAGGGGCGGCATGTCGACTGGAGGGTCCCGCCCGAGTTTAATGTGGAAAACATCACGGTTTTCAAAGAGGATTTGTGTTAGTTCAGTTCGGA
AAGCAGTACTGCACCCCAGCTTCGCAGCCTCCTCCAGCTTAGCTTCCTGTATACTCCACTCGACTACACACTCATCCTCTCGGTCCTGAGCGAAATCTAC
TTATGGAAAACAGCATTGTTACTCCTCTTCCTGTAATCCTTGTTCCTCCGGCGGAGTCGCTGGTTGTTGACCCGTCGATGCATATGCTAGAACCCGTCGG
ACACCGCTCACCTCGAAGCCGTCATCCATGTCGTATATTCCACTCAGGCATTCCGAAATAATCATTGTATTGCTGCTTCAATACAATAGTTTACACTTAA
TTATTGATTTTTACAAATTGGATGACTTTGTCCAATTAGTTATTTTGTATTTACAACAAAGTACTTTATTTTTTCGTAAAATCTAGTTTTTTCTGCTTTG
TTTTGCGTAAATACGGAGCTCTCCAGACAGAATCGAATGGCTGTTAGCAACGGTCGCTCAAAACGCGAACCTGAGGCGCTCGTCTATCATTTTTGATCTC
ACCATGGCTCTCGCCAACACCTTCACGACCAAGCAAGTCTGCAGCTACTTTTTTACTGCCAGCTTGGCGACTTCCAGTCGGCCACCATGAAGCTTAAAGA
CGACAACGTAACGCTTCTCGATGTGCGCGATATCTTTGATGCGCTCATCGAGAAGCATTCCGTTGTGAAAAAGTATCTTGCTGCCGACGCAAATACGTGG
ACTTCGAGCGAGCGTGCGTTGTAGCCCTGTCAGGCGCCGTGGACGAGCTGACGAACGACCAGGAGCTGATGTTGCAGCCATTTGAGACGGTACCTGCAAT
TACGACACCGGACACAAGGCACGGACGCCCACAGGGCTTTGCCGACAGAGTCTTGGCGACTAGAAAAAAGCGGCGCGGTGCAAAGAAGATATTTGATGGT
GTGCTTTTCATCCCGCCGACGTCAGGAGCGTCTTTTAGTGTGGCGAAACATACTCTTTTCCACCATCGCCAGCGTATGCTGCCTATTCACCTTGAAACCG
TGTTGTTCCTGAAGATGAATCGGCGTTTCTGGGACGCAAACACTGTAGCAGCTATCGTGAACGCAAAGTAATGTGCAGTGCTGTACATCTAAGTAGTTAA
TTTTCCAATACACTACTATTGATGTCAATTATTTATTTCTTAAGCTGTAGTTTTTGTAGCAATAGCTTATTTTGGCATGGACCTTCAATATGATTGCAAT
TGTATTATCGGAATGCCTGCTGTCATCTCTCCATCTTCTACGGTCAGCGGAAAGCCAGCGTAAAACCGGGTGGGGACTGCAGAGGTGGCGCCGTGCTTGT
GGAAGCGTACGTCTGCTTCGTGATGAGCTGCCATGAATGGATACGGAGACATCAGTGCATGTTGGCATGTAGTTTGCGCCCGAGGAACGGCCGCTCCAAC
GAATCCGGGGTGTGTGCCAACCACAATATGCTCGTGTTTCGTACACATGATCGTCACGAACGCATACGCGCAGCCCAAGGTCTTCACCGCCAATTGACAC
AGTAACTCGAGGTCGTGGACATCAGGTGCAACAACCTTCATGTCTGTGTGTGGCGTTTCCGGCGCGAAAATGTCGGCGAGTTCCAATAACCCCGCAGATT
TAATGCTGGCGATACGTTCGGCCTCGTTACTTGGAATCGGAGAATGTGGCACGTCGATGTTCGGATCTCCCGGTAGATCCAAGAGATACGTGCGTTCTTG
AGCGTTGATTAGTCTACACGCTTCTAGACTGGGTAATTTACGCTCGTGCTTAGTATCTCCCTGATCTTTTCAACGGCTTCCATCTCTTTGAAGAGAGGGG
GTTGATCGTTGTCAGTATCGCCACATTCTGCACCAGCGTCTTCGTCGTCAGAGCTCTTCTCTTGTCGAAGAAGGATCCGAATTACATCCATAACAGCCAC
GTGTTCTACACTACTAGAGCGTGAGTTTAGCAGAGAAGCAGAGAGGAAATCCACCAGCACCGACACAGTTGAAGCTTCGTCCGAGTCTTCCACAACACGC
GGGGGTCCACTGTGCTTCTCACGCTCTTGTGCTGTCCCAGCGAACACCTCTGAATACTCACAAGCTTGAACGTTGACATGACAGCGAGTACAGACGGTGA
TTGCAGCTACACGTCCAGAAAAACTCTCCATGTGGTCTGCAGTCCAACAGTCAGCGCACACGAGGTACCCGCACAAGAAGCAGCGTCTTGTGTCCAATTT
GAGATGCGCCAGGCTTCGATTTGCAATAGCCGACGCTGCTATTGTTAACGACAACTCCATGGGGGCTAAACTGTGCGTGCAACACGGGCAACGCGGATTC
GCCACCTGAATTCAGCTGATCTTTGCCGGAATTTGCACGCCGAATCGGCGACGACGAATGAGCTCGGGGAGTTTGGTGACTCCATGCGCCATCGCCAACA
ATCGACGCAGTTGCGCCTTGTGCTTGCTAGTCTCACCATAGCCGAACGGGAATGGCGGCGCGGATTATCACTCGAACTGGTGTTGGAGCTGGTCGTTTCG
TCGCTTCTCCGCCTCGACGTCGTGCGTTTGTCAGCGGATTCTTCCACGTTAAACCAGGCGTGGAAGACGACGCGCAGACCTTTGGGATTGGGGAGTACGT
CGACCAGA