Description :
From Genome Similarity Track
Location :
Scaffold_2293:796- 3552
Transcript NameFunction/comments
Phyag_g12308hypothetical protein

Sequence
2756 bases(100 bases per row)
CAATAATGTGTCAACTCGTCTTTGAGAACTAAGAGGTACTTCGCATCCTCATAGCTATCGCCCATGGAGAGGTAATCCATGTGAAGCACCTCGTTTCGCT
CCGTGGACGTATCCGTGTCAGACCATGGACGCTGAATGAGCTTACCGCCTTTAATATGTTTACATAAGAGGCATTTGTTGAGAAATCTCGACACAACTTC
AGCAAGATGATCGATCTCGAAACGCTGCTCCAACTGCGCGATCATGACTTGCTGGCCGCGATGCGCTTGGATGCCACAATGAGATATCAGCAGCACTCGC
GTTAATAGATCCTTTGCTTGTCGGGGAATCCACAACTTGTGGTTCACGAAAATTAAGCCATCACTTTCATCAAAATCTCCGGTCAATGATCCCCGAAAAC
GAGTCTGAGCTTCTTGAACGGCTTGGTTTGAAGGCCATTCGAACGAGTCATCCTGGAATGGACGCAACAAACTTGCCGGTGGTTGACTTCGAGTTCGCAC
AGCCTTAACCTTGGTGACCACAGCAATATCTTCGCGCACTGGCCAACGAGAGATGATGTCAGCCCAGTGATTCTTCTCCCCTTGCAAGTGCTCAATGGTG
TAGCGAGTGCCAGATAATTTTAACGCCCATCGCTGCAATTTACCACGCACATGCTTTTTGACTTCGTGATCTGGGCAGAAAATGTGGATCAAATTGGCAT
GATCCGTGTAGATGCGATATCCTAGACGCCTCTGGAGCAAATAGTCAAGCTCGGACGCTGCAAACACCACAGGAAAAGCTTCTTTCTCGACTACCGACCA
CTGCAACTGGGGCCCCTTGAACGATCCACCCTTGCAAACTAGTAACTGGTGATTCTGCTCGTGCACAGGTACACCTTCTTTCCAGTTTTGAACCTGAGTC
ACCACAATTGCCCAACCTCGGTCCGATGCATCAGTACTGAGGCAAACAATAGCGTCATCATCTGGAAATGCCAGCTTAGCTGAACTGGCCAACTTATTCA
GAAACACCTTGTATGCATCAACCTCGGCAGGACTCCACGTGACATCCACTGTGGCAGCATGGCGTTTGCGCCTGCTATGACCTTGCAACACTGCATCAAA
CTTCTCCTGCAGAGGGGCAACAACCCTTCCATAATCGACAACTGAGTCGCGGACCCAGTTCGCGGCACAGAGAAAATGTTGCAGTTCTGCAGCATTTTGA
GGCAATGGGAGCTTCACCAGCGATTCAAGCCGGGCAGGATCATGAGTGACTCCTTGTCCATCGATGATTTTTCCACACCAATTGACAGCTTCCTGATAGA
tgacgctcttcttcaaattGAGCTTTAGTCTTAGCTCTCTCAGGCGCGCAAaaaacttctccagcacttgcaAATACTCTTCGTGCGACGATGCAAAAAG
GATAACATCGTCAACGTAAACTAGTAAATGCTCGTTGATTAAGTCAGCGAATGCCTCCTGCATTGTAGCTTGAAAGTGAAATGCTGAGTCAACGGCTCCT
TGAGGCACACGGGTGGGAGTGAATACTCCTTCATCCGTTTGAAAGCTGAAAGCTTCACGACTGTCTTCATGGAGAGGGAGCTGCCAAAAGCCCCGAAACA
TATCGAACTTCCCGATGGCTTTAGCTCCCTTTACACGACTGGAAACAACGGCAAGGTTCGGCACGCTTGCTGCAATAGGGACGGTCATACGATTGAGAAG
ACGATAGTCGCATGTGATACGAAAATCATCAGTTCCTGCCTTCGGGACAGGAACCACAGCACTGGCCCAGCGACTAGCGTTATTCGGATAGACGTAGCCA
CAGGCAATTAACTCCTTGGTGTAGTTGCGCATGTAGGCACTGGCGAGGGGCGCATAGCGACGAGGTTTGCACCGCACGGGCTGACtgtccttcttcagca
ccagacGAAATGGATCAACTCGAGCAGGCTCGTCAACTCCCAAGCGAATGCGCCACAAATCTCGGTaatcagcaacaacacgtCTGAGAGAAGGCATAAG
CGACTGGGAGAAGCCATTTTCATCGGCCTCATGAAGAATTTGGTCGATGAGTGAGCTgacttcgacatcatcatcacGACCAACCTCGGGATCCTTATCC
AGATTGTCACCATCATCGTTCCGGACTCCATCAAAGTTCCCAGCGGCGAGTTGCTCCATCTGCCGGTTAACATTGATGCCGAGNCACCTGGCAACCGCGA
TGACATGCTAAGTGATCTCCACCAAGACGCTCCAGATACACTGGCCGGGCCAATTGCGAAACAGCCACCTGTGACCCGCACTCTTGTAGTTCCTGCACGG
CCGCTGCTGACAGGACATTCACATCCGATCCAGAATCCGCCCTGTACGGAAGCTCAATTAACTCATTGATGATCACGAGTTGATGCCCCGGAATCTCACC
AGTTCGTGCAGCCTTCGActtcgccaccttcgcgtCCTTCATCCGCTGGTAGCACTCCTGTTTCTGCTCCTCGGTAGCGGTGGGGCAAAAACGAACTGTG
TGTGGTCCTTTGCAGAAGAAACAGCCATCACGAGGGGGAGGACGTGGCGTGGCCCCCGTTGCCGCACCTATCGCAGCATTCCCATCGGCTTTTGCAGCCA
CCGTTTTTGGTCCTGTTGACTTGGTGTCGGGCTTCTTACTGTCAGATCGCGCTGGTGTTTTGCTGTTTTCAGACTtggtgagctgcttgcgttcAACCTT
TAActcctgctgcatcgtgTGATAACGTTGTTGTGCCTTGGCCCTTTCCAGGATGA