Description :
From Genome Similarity Track
Location :
Scaffold_2271:796- 2944
Transcript NameFunction/comments
Phyag_g12279hypothetical protein PHYSODRAFT_552366
Phyag_g12280hypothetical protein PHYSODRAFT_349212

Sequence
2148 bases(100 bases per row)
GTCGCTGGCCGAGGAGAagccgacgccgccgccgcgcgtGATCCcggcggcgcagcaggtCAAGGTGACGCCGACGGGTgacctggagctgcagctgctg
tcgctgagCGAGGATGCGGAGGATCAAGAGCTGGGCACCGTGACGATGGACGGCGAGGTCTTCGGCGCGCCCGACCGCGTGGAcatcctgcagcgcgtgg
tgcgCTGGCAGCTGGCGTGCCGTCGCGCCGGTAccaacaagaccaagacgcgCTCCGAGGTGAGCGGCTCCACGCGCAAGCCCTGGAAGCAGAAAGGCTC
GGGCCGCGCCCGTGTGGGCGACATCCGCGCGCCGCAGTGGCGCGGAGGCTACCGCGTGCACGGCCCCGTGCTGCGCGACTTCTCGTACAGTCTGCCCAAG
AAGGTGCGCGCCATGGGCCTGCGCGTGGCGCTGTCGACTAAGCTCCGTGAGGGAAAGCTGGCTGTTGTGGACtcgctggacgtcgacgtacgttgctgtt
gtcggtTATAGTtcgtggtgatggtggaTATTAACGGGAACTGGTGTTTCTGAGCAGGTTACTAAGACGAAGGATATGAAGAAGCTTCTGGGCGGACGTG
GATGGGACCACGCGCTGTTCGTGGGCGGCGAGGAGGTGGGTACGAGCTTCGAGCTGGCCACGCGCAACATCCCGTACGTGGACGCCATCGCGCAGAACAA
GATCAACGTTTACTCGATCTTGCAGAAGGACCTGCTGATCATCACCAAGGACGCCGTCAAGTACCTCGAGGAGCGTCTTCACGTCGACtagagcagcagt
tcgaggGGTGGCACGTACAGACAGGAAGGCGAGAAAAACGAGTGAGGTGGCCCCAACTCAACTTACAGATAGAGCGTCGCTTGATGTTTGGGAAGCACCG
GAGGAATGCACTCGTTGTATCGCTTCAATTATCCCCCACTTCTCCACCACAATAACCTTTCTCTCCTTAGATTGATGGCGCTTCACTGAGATCAACAGTC
GGTGAGAGCTCCGGATGCTTCACTGTAGCCCGCAGTCGCTCTTCCACCGGTGCAGGCTCACTGATCTCGATCGCTGCCGAGTCGCAGGCATTCAGTAGAT
GTGCCTGACCCAGAAACTCCTTGGCTTCCGTCAGCTCCACCGTCAGGGCTTCACGTTGCTTGGCCATAGCCGCCTCCAGTTCGTCTCGTTTGGCCTTGAA
GTTGCGGCCATTGGCCATCACCTTCATGAGTGTCTGCTTGATCACGCGACTCTCGCGCTTGATCTccgccaagtcgctggcgctggcgccTGCTCCTGGC
CCATACTCGTCCACTGCCATGCGCTCCAAGTGCCAGCCATTGAGGTCGCCCATCCGCGCGTTGGGCGCACTCAGATCCAGAATCTCACGAAAGTTGTCGA
CATTCCGGCGTTGCTACATTCTCAAATCATACAGTTAGTGACGGATCTGCGGGTGGTCTCTAGAGAAAGAACGTACGTCGTAGACCGCCGCGAGCTCCAC
CCACTTGCCGTCCAGGTCGTTGCGCGTGTACAGGTCGCACAGGTCGCAGATGGTGGCCGCGGCGGTGGCACCTGCAGCCGCGCTGTCGTCCTTCCCTTTT
CCTCGCGGTAGCATGACAGCCAATTACCGGCGCGAGGCAGATACAAAAATGGATAAAGTATCAAAAAGCAAGGTGGTGCTCTTCATGAAAACATCGAAAT
GTGGGCTCAAGACCCAAGCTTTCCCACGCTTCCATGAACTGCTTAAAGGCGTGTTGCTTTAGCTCTTCCGTGTGCTGAGTTTGCTTCGCTTCGCTCTTTT
AGTCTGCGGCCACATTTCTCGCGTTTTGGCGCTGGGCGAACTGCTCTGAttccactgctggtggccacTTTCTCTTGCCGCCAGCATGGCGAGTAGCTCT
GCTCTTGACACTTTACAATCGACCGCCGTACATGTTTCTCTTGGTGGAGTCGCTCAGCCCTTCGTAGGCGCTTTAGATCAACTGGAAACGTCAAGTGGCC
TCCTCTTTCGACACGCCCATCGGCTTCTGCTGATGTTTGTTCACTCCTTCGTTACGATACTCTTCCTCTGCAGGTGTAGCATCGTTGTTCGTGCAACTGG
TCACGAAGGCGTTTaatctcctgctgctgcattcgaAGCGGCCGCTCT