Description :
From Genome Similarity Track
Location :
Scaffold_500:796- 2652
Transcript NameFunction/comments
Phyta_totarag8836hypothetical protein

Sequence
1856 bases(100 bases per row)
ACAAAGTCCGTTTGCGAGCGAGAGACGATAGCTCGTTCGATCGACGTGAACAGCGCAGCACCGTGATGTCCAAGGACGTCTTAGCCGCCAGCAGGGACAG
TTACCAAGGCTGCGAAGCCAACCTCAGTCGTGAACAGCCCCGGGACGATCACGCGGAACAGGCGAAGGAAGCGGAGATAGAAATCTCGATTCACTGCCAC
CTTCGGTTGGTCTTTTTGCTTCCGTGTCATGAACGCGGACTCTTGAGTAGCTGTGGGTGTTGGTCTTCTGACGTCCGTTCTCGCGGATTACAAGAGCCAA
CGCTACCAGGGCAGTGATGCTGGCAACTGCGTTCCTCTTGGACAGACCCGTCATCGAGTTTGAGGCCTTGAGGTCACTTTGAGTTGTGAGCTCAGGCTGG
AAACTAGTGCTGCGATACAATCGAAGAAGCGAAGACTATCATTGATTTCGTCCTGTTGTCATGGAAGTCAGTAAGGCAACCAGGAGATGCGGGGTGCTCG
CTCTTCATGACCGAGATTAGTAAAGGAATCCGTTATCGATGCTGGTGTTCTCGACTAGTGCCGCGGACCACATCAAGCCCATCAAAGGGGACAAAAGCAA
GTCAATTGCAGATCGTTTGGCGACCGATTTCTCACTGCAATTGTCCATCTCCGTGTCAAGTCGAACGTAGCGTTCGAGACGATATCGTGCTAACTGCTTG
AAACGACGCccttccacttcaagcagcagcgcggcAAGTCGCCTGGGGAATAGTCAGTCAGTCTCTCATATCGGAGCCCAAGCTGCGCTACGCATTAACC
ATTGGCACCGTGTTGCATCTAGTGGAATACTATGAAGAGTGCACCTGGACGAGGAATCACAGAGTGTCAAGCTGTCccggacgaggacgacacCAAAGCA
TCCGCTGCGCTTCAACGGACGCCTCGTGACGACTCCAGCGAGACGGAATCCAACAATTCCAGCATGGCACGAAGGGTTGCGATGCCAGGCAGCTCCAatg
cttcttcctcttcggaCAATGAGGCTTCGAAGGACGGAGCCATGCCTCGAAGTCACCGTGCAGTGGACGTACTGCGTCAATCTCCAGTGGTGGAAATGCA
TCGCACCTCAAGTGGACGGAATCTGCAGCTCAAACATCTCTCGGTAGCGGACGGGGCTCTACTGTCGGCACCGAACGCATTGACACCTCGAGCGCCTTCC
GGACGGAGACCTGAGAGCAGACAAAGATTGCACAGCGCTGATTGCAGtaacaacaacagcagcagcaacaacagggACAGTCTCTCAcagcgaagcagca
gcttttccaTCTCGGCTCATGTGTTGAAGGATCTGGAGCGTGTGAGGTTGTCGACAGACCCTGAAGGACTCGCAGAACTTTATGAGAGACCGGAACATCA
TCCAGCGAGATgtagcgacgacgacgacgacgacgacctgcAACAGAAagaagacagcagcgacgagagcgaggagatCCACTGGGACACACGCGGCGAT
ATTTCTCACAACAATTCGGAAGTCCACCATCGCCTCAATCAAgcagagcaggaggaagaacAGGTAGAGGGCAAGGCGGTGTCGACCTTCGGTCTGTGGG
GGAAAGCTGCCAAGAACAAACGCTTGCCGGACGCCATCATTTTTTCAGGATCCGCTGCGGACGAGTGCAAGGTCTCACATAGCCGTTTATCTTCTGCGTC
CTCGTCAAGTAGAGTCCAGCAGCCTATGGAGACCAGTGTCCCGACAGTTAGTGAAATGGTCTCACAGCTGCACGTAACACATCCGCACCTAGCAGCGCTG
TCAGCGTTAGACGTTCCGAAGTCCATGTCACTTCCGCGGTCGACATCACCTCGCAT