Description :
From Genome Similarity Track
Location :
Scaffold_40:79582- 81241
Sequence
1659 bases(100 bases per row)
GCACAAGACGAGGAGCAGAAGTGGTTTAACATCAAGAAGGTGCTTCAGGGCCAAGCAGAAGAGCTGAGTTACAAAGAAGCTCGAGATGCCTGGAAGTATG
CTGACCGGTTCGTGTTATCAGAAGACGGCGTGCTTCACTATCTTGGATTGAATCGTCGGTACGACCACGGTTGGCAAGAGGAGACCAAGCTGCGGCTTGT
GGTACCGACAACGATGATTCAAGAAGTCTTGCAGAACTGTCACGACTCGCTGGAAGGAGGACATCAAGGTGTGGTGAGGACGTTCCACCGCGTTAAGTCC
GATTATTATTGGATCGGCTTGTACGCCGACGTGGAGAAGCATGTGAAGTCATGTCCGGATTGCAGATCGAGTAAAAGCCGTCCACAGCTTCGTGGATACT
CACCTGGTAACGTGCTAGCCGAACGACCTTTCCAGATCGTCTCGATGGATTTTGTGATCCCACTACCGAAATCTCGTAGGGGCAACACGGCGTTGCTCCT
ATTTCAGTGCTCGTTCACGGGATTCGTTATTGCCAAGGCTATGTCAGATACGACTGCACTGAGTGTTGCCCAAGTGTTCGAAGAATGTGTGTACCGACGA
TTCGGAGCCCCATCATTAATAAGGCACGACCGCGACCCACGCTTCATGAGCGAGGTTTTCCAAGCATTTGCGGAGATGATGCAGTCAAGATCACGAGCGA
CTTTGAGCTATCGGCCACAGGCTAATGGACAGCAGGAACGCTCGGTGAAGTCAGTGATGGGGTCCGTACGGGTGTACGCGGAAGACCCTCTACAGCAAGA
TTGGGATGAAATCGCGGAGAAGCTAGTATTTGCTATTAATACTTCTCAAGACACTACGAGGAAGGAAACGCCGTTCTACCTCGTTCATGGTTGGGATGCG
CAGTCGACGTTGCGGGCAATGTCGTCATCACTCAAACGAGGACTCGGCAAGCAGTCTGACGCACTGGCGTGGCGACGCGAGATCAATCGACAACATGAGG
TCGCCCTCACTATGGCCAAAGATTATCAGGCTGTAGAAAAGGAGCGAAGGGCTAAAAAGCATAATGAGGCCCTGAGTCGACTGGAAAAAGCTGCTGTACC
TCAACCAAGTGGAAACGAACACTCGGCGAACCCTCCGGAAGCTTCGGAAGAGATTGAAGATCCTGGAAGAGCTCCACCGAGATCTCTTTTTGATATTGGG
AGCCGGGCGTGGTTGTACATGGAACGCGTCAAACCGGGCTTGACGAAGAAACTAGCTCACCGATGGCATGGACCTTTTCGGATCAAGCGCAAGGTGGAAG
AGTTTGCGTACGAGCTGGAACTGCCTGATCGAAGTGGGTATCGCTTTTACCCAGTAGTGCATGTGTCAAGACTCAAGGCTGTCAACGAATTCAACAGTCG
ACCGAACACTCGGTTGGTACTTGACGCGACTAATGAAGCAAGACTCGACTTCGATGAGGAACTACTGCCTGAGGACAGTTGGGAACCAGATCAAGTTGCC
GGTGAATATGAAGTCGAGGCCATCCTCGACGACAGAACACCACTAACGACGAGCACGGAGCGTGCTGTACGCGAGTTCAAAGTCAAGTGGGTGGGCTATG
AAGATACAACTTGGGAGCCATCATCAAACTTGTCATGTGGAGGTCTGCTGTACGACTAT