Description :
From Genome Similarity Track
Location :
Scaffold_135:7958- 10651
Sequence
2693 bases(100 bases per row)
ATGCGTACGGGCAATATTAAAAAATCCTAACGATCACTTTTATCCTTGGTCAAGGTATTTCAGGACGTGGTGTGCCGCGACCCACCCTCGGTCTTTCCTT
CAGATAGAGGTGCGCGTCATGAAATTGAATCGGTCCCTGGAACCAAATATTCTGTCGCACGGCAGTGGACCTTAGCAAAGGAAGCGTTTAATTTCATTGA
TGACTTCTTCAATGCCAAGCACGAGGAAGCAATGTTACGGGAGAGTAAATAGTCGAATTCGACACCGACCTTTGTGTCAAAAAGACGAACGGCAAGTGGC
GTATTGTGCATGCTTATAACAAGCTTAATGCGGCCACTATTCCGGCACAGACACCCATTCATCGATAGGACGTTCTTCAAAACAACATGATTGGCGGTAC
TACGTATAGCGCACTCGACTTAGTCGATGGGTATTACCAATAGCTTATGCGAGCGAGTGATATTCCACTGGCAGCAGTGAGCACTCCGGGTGGTATGTTA
GGAATAGTTGTCTATGCCCCAACGACTATCTAGCGTGCCCGATACGTTTGATCGTCTAGTGAAGCAACTTTTCCGTCTCCGTCGAGGCTATGCACATATA
TATTTCAATAAAATTTTTGTATATAGTCGTGCGGATCAGGGACGGTCTGTTGTGGACAATCACATCGACCATTTATGAGCAGTATTTAAATGCATGCGCA
CAAATAATTTGTATACCATACATCGAAATTGTATCTTCGGTGCAGAGGGGGTTCCTTTATCGGGTACAATATCGAGAAGCGCGTTCTCAGAGAGGTCCCA
ACCCCCGCTAAGGCTGATCCAATAAGACTGGCCGATTCGAAAGAATCAAAAGGACTTACATAGGTGACTTGATATTGCCAAGTACTTATCCAGATACAGC
AAAATTACGCTGATATGACTAGGCCATTAACCAATCGCCTTGAGAAGGACACGGAGAATTGTTAAGGTACATTACATGGTAACACTTCCGAGTAGTAAAT
GAGATTCTAATACATGCTCCCAATGTAACGTTTCCTGATCCTGAGTACTATTTATTGTGGTCTGTGACGCATATGATTTTTCCATATGCAGCGCTCTGTT
TCAAAAAGACGTTAAAGTTCGTGAGCGTTTTTGCTTATGAAATTCGTCAGCTCACGCTGATACAAGGAACTATCCAGTATAGGAAAATCAACTATTTGCA
ATGACGTATGATCTAGTTAAATTTATAGTTCATTTGCTTGGCTCCATGACATTCGTCCTCTAGACAAACCATGCATCTTTACGCACGTCCAACAGTTCCT
CACCTCTCTGAGAAAATGGCTCGTCGGCTTTCCTTCTTTGCGATATTTTGCGTCGAGTTGCAGTAAAAATTGGGAAAGCAGAATGTTTTAGAGGGTGCTC
TGACTCGCCGACTAGCTTGTTAATATTACTACTTTGTCTTCACCCATCGTAATTTTGATCCGTGCGGCATATGCAAACGATACTCAATGCGTGACAATGA
TCCCTGCTCTTAAGAGGAACATACACAAAGTTATAAACAATGAGACATCGGCACATTACGTGATAAATCACATCAACGTTCCGCCGACCGTTGCCTCCTG
TGGTATTCCACGGATGTAATAGATGAGTCTCACATTTTCGTGTCTCCTAGTGATGATTTAAAGTATCGAATCTACTTTGATGTTCATAATACTACTCTTA
GTGGAAAATGGGCCTGGAAAGATTAACGGCTCTATGAGATCACACTACTGGTGGTCCAAAATATATATATGGGTCAGCAGATACGTGCGCACATTCAAAA
CTTGTTAGCGGGTCAAAACCTCGACACACTCGGCGGCGCCTCTCAATAGTTTACCCGTACCCACTGGGTGTTAAGATTCCATCAGTATGGACTTTGTGCT
CTGTCTTCCCAAAGACAGCGATGGCAGTACGGGCATCGTGGTATTTGTCGACCATTTAAGTAAATGGATCACATAGCATCTGCTGGACTTCATTGATCGG
GTTATGTACAACTATGCTGCTAGTGACCGTGCTTTTTGTCACCACTATTCGCCGGTGCCAATAATCTCTGGTCGTGGTCCTCGCTTTAATTAAGCGTTTT
GGATTTCAATCCTTAAATTGCAAGGCACACGATTGGACATGTCCACAGCGTAATACCCGCAGATCGATGACCAAACTGAGAGAGTTAATAGCTTCGTCGG
CCATGTAATTCGTTGTGCTGCGTCGTCTAAGACTTGGAGCTCGATGCCCTCTGTCGTTAAATTTGCGTTGAACAAAGCCGTTCATGACTACCTCTTTAAG
TCCCTTCTACTTACGTAGCCTCACACACCCGCGCGTCCCGTTAACGTTGCCACTGTGTGGTTCATGGGTTGGTGGGAATGAGTTTGTCAAAAATCTTGAT
AATATCAGCCCTACGACTATGCAGCAACAGTAAGCGAGTATCTTGCTACGCGATCTAGTTTCTACAACGAGTACATGATACAATGGCTATAGACAAGATA
AACAAAACAAATAAGCTGCTATTAAGGGCATAGGAGGTATCGATTCTCATGAAGTAAATAAACAAGTCGTACTAAAAGCTAAACCTACCTACAAACGTGG
CGTCCGCTGTCTTCAGCACTAAGCTGCGTCCACACTTCATTGGGCCATCCACGTCGTAGCTAAGAATAGCCTTGCCTATACGCTAAATTTTCC