Description :
From Genome Similarity Track
Location :
Scaffold_1006:7957- 10418
Transcript NameFunction/comments
g14386.t1hypothetical protein

Sequence
2461 bases(100 bases per row)
ATGCCCACATAGCCATGTGGCTCGAAGGAGGACGCGTACCCCGTGCTCCTGGTTTCGTACTGATCGGGTCACGCCGGTATGCTGAGTGGCAAAACCTAGC
GTTTCAAGCCACAACAGATCAGCAACCCGAGCAAGAACCAGACACGAGACCCGCTGGACCGATGGTAGACCGACCCCAGTACGTCACACCGACGAAGATC
TGGAGTCGAGACTCCGGGGCGTCGAAAGTAGCGGTCGCTCAAATCACCGAGTCCCGCCCTGTTGAGACGAAATCGAGGACAAATGCCCCCGGGATCAATG
GGGCGCACGAAGAGGGTAATCCGATCGCGACGGAGATGTCGTCAGACAGAATGGAAGAGCGAAGTGACGGGATGCCTATCGGAAGAGCGCCCATGATCGA
GCCGAAGACGCCGCCGATCACCAAGTCGGAGATACCAGATGACGACGAAGTCTGTTACCATGAAGGAGGCGACTTGTTCGCGGAGGATGTGGAAAAGCAG
ATGGCTGTCTTGCCTGAGGTAGCAACCACTACCGACGAAGTCACGATCGAAGACATTCAGGTGAGAGACCCTGATTTCAACACCCCTGAGGAGATCGATC
GTCTGCGGCAAATCATCTGGCGCCGGCGTCACCTACTGATCGGAAAGGGAAACGCGTTACCCCCGGCGGCTGTAGGCGCGGTGTGCGACATCGACGTTGG
GGGAGCAACTCCGGTCGCCCAACGCGTTCGCCGGGTCGCCCCACAGTTTCGCGAGAAGCTGTCGGACCTGATCAAGAGTTTGCTGTCTGCGGAGATGATC
GTTCCGTCGACCTCGCCGTGGGCATCCCCGATCGTGATCATCATCAAGAAGAACGGTGTTGACATCCGACTCTGTATCGATTACAGGCTGGTGAACGGAT
TGACACGACTGATGGTATATCCCATGCCGATGATTAACGATCTCTTGGAAGACTTGGACAAGGTGCTCTGGTACTGCTCCCTCGATATGGCCAGTGGCTT
CTGGGTGGTGTCTATGACTGAGCGAGCTCGGAAGATCTCTGCTTTTGTCACGCCATTCGGACTTTTCGAGTGGACGCGCATGCCTTTTGGGCTGAAGAAC
GCTCCACAGATTTATCAGAGGCTCATCGACAATGCGTTGTATGGTCATCTCCGAATCAGCGCTAGCCATGATCTGTCGACGCCGATTGATGTGTTCGAGG
CAGGGGAACCAGAGCCGGAACTGAAGCCGTCCGTGCTGGGAAGACGGTCGTACATCGACGACATTCTGGTTACGGCGACCACTTGGGATACTTTATGTGA
AAAGGTTGAGAGGTTGTTGGACGCTTGCGAACGCTGGAATCTGTCGATCAGCGTCGTCAAGAGCTTCTGGGGCCAGCGCAAGGTGGGTTACTTGGGGCAT
CAGGTGTCTGATGATGGTTTGGAAGCTCACCCGAAGGACCTTGAGGCGCTGAGTAATCTCCCCTTCCCGCTAACGCTGCGAGCGATGCAGTCGTTCCTTG
GAAGCTTGAACTACTACAGTCGCTTCATTGAAGACTTCGCGATCTACGCCGCCGTCTTATACGAGTTGCGCGAAGCGGACTTTCATGAGATCGGTCGTCT
AGAGAGGGTCAACCCTGGCCGACAAATGACTGGGGGCGACGAACCACAGATTCCGGACGCTGATCGCTGGACCCGAGCGAAGATCGCGTTCACAATGCTG
AAGGCCAAAATCGTGTCCACACCGATCCTAAAGCATTTCGATCCCGATCGCACTCCAGTGATCGTGGTCTACGCGAGTCAGTGGGCGATCTCTGCGGCAC
TTGTGCAAGAGCATGATGGCGTGTACTGGCCAGTAACTTTCACCAGTCGTACTTTGAAGTCCAACGAGCTCAACTACGGAATCGTCGACAAGGAAGTCTT
GGCGCTTTTACGGATGCTGGACGTGAACTACACCTTGCTGACGACGAGATCGATCTTGGTGTTGTCCAGGCACTCGACGTTGGCTTGGCTAGTCAACTCA
GCCGGTTTCCAGGGAAGACTCGGCAACTGGGCTGCGCTGCTCTCAGAGTGGACGTTAGAGATCCGGAAGTGCGCGAAAGGGGAAGATGAAATCCTGGGTG
CGATTGCAGCCAGCATCACACCTCGTGCCGAGGTAGACGAAGCGCTGATCGCGATTGCACCGGTGAAACAGCCTCGACAAACGATCCTCATGCCACCCCC
CACGGTTGAAGCGGACGAGAATTTGTTAGTCGCAAGCTTCGATGGATCAGCACGTGTTAAACGTAGCGGTGGGGCTTACAGTGCGATCATATGGAAGCTC
CCCGAGTGGACAATTTTGTCAGCCGCGTCGGAGTACATGCCCGATCTGACCGTGAACGAAGCTGAGTACCGCGGGTTGTTGTTGTGTTTTGATCTGCTGT
CGACTTTGGACCGGGGGCGGATCGTGATCTGCGGTGATTCCAACCTGGTGATCCGCCAGAT