Description :
From Genome Similarity Track
Location :
Scaffold_323:7955- 12908
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_323-snap-gene-0.14Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_323-snap-gene-0.15Conserved gene of unknown function

Sequence
4953 bases(100 bases per row)
ATCTGCAGCGCGAGTGCATGTTGCTGGGCGCCATCGAGCGCGTCACTTTGGAAGTACGAACTCTGCAACGCATGCGCAAAGAGCTCCATCGTGAGCTTGA
GCGTCTTGTTGTTGTTGTCCGAGAGCATTCGCGCGCTCAGCCATTCAAAGAACGCGGCCTTGGCGATCAGGTACGCGCCGCCNNNNNNNNNNNNNNNNNN
NNNNAAGCAAGCACTCAGGATCTGCGCGATCAGCGCCTGCGTGTGGTCATCTGCGAGCTCCGAGCCGAAGAAACTGAGCAAGATCGGCAGTACGTGGCGA
CGCACAAGCAGCACGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCGTAGAACATCGGCACGTCGTTGACGTCGATCGCCTGACGCGCGAGTAAAAAGTGGTTCACATGCGGGAACAGCGCGTGCACGGGGCGG
CAGAGGATCGAGATCGCATCATTGAGAAAGACCGTGATGACAGACGAGACGCGCGCACGTGGGGACTCGATCGCATTCCGTAGACTCTCGAGCAGCAAGT
GCACTTGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACGACTGCGGCTTCGGGCAGGTCCGA
CGACGAAATGAAATGCGACAGCATCGGCAACAGGAACGCTGGGTCATACACTTGGAAGCGACCATCACTCATTGCCTTATCGCCAGCACTCACTGGTGTC
GCGTCAATGTCCTCCACGTCGGCGTCAAATGAAAGCAAGACAACATCATTGGCGACTGCGACCTCGCGGTGCAGCGGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGGCTTCGTCGTCATTTGACAGGATTGTTGTCGAGGACGAACCGAATCGGAACCCGAATTGCGCGAGCGAGATGCCCGCGTTCTCG
TCAAAAGTGTCCAAGAGCACGCGCAGTGCACGGTCCACGGTGCTCAGCGACATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTACACAGCACTCTTCTGAACGAGCCAGTACACGACGCGGATGAGCAGAAGACGTGCGTCTTCGT
CGCTTTCATGATCGCCTGAGGCTCGCGCTACCAANNNNNNNNNNTGGGTGCTCGGTGATCGCGCTCAAGTGGTCGGCAAAGCTGTAGGTCGTCACCGCTG
CATCGACGCTCGTCGCGAGCTGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGGTACGCCGCCATGGACGCGTAGTCGTAGTCCTGGGCACGCGTCAATTGAGGCCCAAGCTTCTTCAGCAGCGCAATCGGGTTCACCGTGGT
GACGCTGCTACGCACTAGGTCGCCGACGATCGTNNNNNNNNNNGCGTCCTTGTCGTCGGATTTAGATTTCGAAGACTTGGTGAGCGATTGAAGAGCGCAT
TTCACAAGGAGCACGACGGCCGCATCGGCTGCTCCCTTGCTCATCGCGTGAGGCGGGCTGCTGGAGGAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTTAACAGTAGCAGTGAACTCAGTTGGCTGGACGAGAGGATCGTGCCGTCTGGGAAGCGCTTGACGAGCGTCTGGAACA
CGGTCGACGCGACATTGGCGAGCAACCCATCGTGGTCCAGTAACGCATGCCGCACGAACGAAAGCCTGGTACGGTTGGTGCCGTCCTCGATTTCGCTAGT
GATCAATGCTTTGAGTGTCTCTGGGGCCAACGAGCTCGCGTGTTTCGCCAATTCTGGGGATTCGATGCGCGTAAGCACGCTGAATACCGCTGTGAGAAGC
ACCATCGACCGCGTTTTCTCCTCAGTAGGCAGCTTGGCTGCCAGTACGGACTCCAAGGTCGCCACGAACGTGGCCATGGCGCGCAACGACGCCGCGTCAT
CTTCACTGCGCACCGAGAGCACAACGCGTCGCAGCAACTCGGTCGTCGTGGACAAACGGTTGTTGCCCGATGCTGCCGCGTGCATGAGAACAGGGATAAT
GGTGCGTTCTACCGCGTTTTGCGCAACTGTGGCGTCAACGCCACCAAGTTTGCCGACGATCGAAAAGCCCGACGCGAAGAACGAAGGCATCGAGGCTCTT
TGTCGCAAGGACGGCAAAAACAGCGGTGCTGCTGCACGCTCCAGCAGATCCCAGACGCGTCTAGCGAGTAACTTGCGTTTCTTGTACGCAGCAAAGGATG
CGTACGTTGTTGTCGTCATGCTGCTGTCTGAGTCCAGCGACTTCAGCAAATGCTGCACGAGCACGCTCTGAACCGAACGCGTTTGCTTGCTGCTGCTGAA
CGCGTGCAGCAACCGAATACGCAGCGCCACTGGCAGTAGCGGCGAGAGCAGCAGCACGGACGGGATGCCCGCACGTGGGAGTAGCAACTCCGCCCATGAG
GACACCGAAGCAGTAGATCCTCGCGTCGTGTCAAGCAGTCGCAAGCCTGTGATCTCGAGCGCAGACAGTTTGTTGTTGGGCTTCTTGTGTTGGCCCACTG
GGTCCGCGATCGCGTGCAACTTGCGGAAAATGCGCTCGATCTGGAAACGCGCGAGCGCATTTCCATCCAAGTCGTTGGCCGTTGAGACGACCAAGAAGCT
CAGCACATGGAGCAGCAGTGTAGAGAGACCGTCGTTGTCGTTAGTACCGCTAATGGACAACGAGTAGCGCAGTGCGAAGAGCAACAGATCACAGATTCGC
ACGGCTTCGGTCGTCTCCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCACGCGCTGCTTCACGATACGCAACAACGTCGAAGTGAC
ATTGTCCCTTTGGCGTAAGCTGCTTGAGCACAGCAGCACACTCTGTACGACGAGCCGCAAGGGCAACTCGGCCAAGAAGCGTCGACTGACCTTGTTGCTG
CTGGCGGAGCTAAACAAATCTAGCAGCGAGTGGTTGTTGTCGCTGTCACCGCCGACCCAGGAACCGATGTAGTGGACTACAAGGTCAAAGGAGCCCGTGA
CATCCATGGAGTTGGCGACAATTTGCTCCCATGAGGCCACAAACGCTGCTGGGGTCGCCGAAACCAGTTGCGACGCGAACGAACGGCGGGATTTCGCGAA
GCTCCACGACGCCACACTTGTCTTTTGCTTCTTCTTCTTCGTGTCGTCTAGAGACGACGACTTGGCTTTNNNNNNNNNNNNNNNNNNNNNNNNNCACGCG
ATTGCACCGAAGGACTCGCTGGCGCTGTGAGCGCGTTGCAGTACTCCACGAGATGCGTGTACGTGTCCCTGTTAGATTCAGGCATGTTGTCATTGTCCCC
ACGTTTCCGCTTGGTCGCTACTGGGCCTTCTTCTTCTTTCTTCACGTCATCACTCGCGCTAGCACTTGAGGTGATCAACGAGACCAACTGCTGAGGCGCT
TCAATCGACGGGAGCAGCGAGAGCAGGATGCGCGTCCCAAACACGACGACGTCCGGGTTCGAACGGTGCGCAGCCAGTGGATTCGAGTTTGTTGTCGACG
GTTGCTTGCTTAGGAACGACACGAGCGCGATCGTACCTGGGCTGAGCGACAGCGGCTGCTGGTGATTGCCAGCGCGCGCATGGTATGTGGCCAAGAACTG
GAACGGATCTGCAAGCGCGTTTTGCACGAGGCGTTCGAAGAACGCAGCGCACGTGGCGCCGGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTCTGCTCCCTGGCAGTGATGTCGGTGCCAAAGACCGTGGAAATCGACAGCGTGCGGTGCAGCACGTGGCCACAGAGGTTGCGAAT
AGCTACGTTCGGAGTTTCCACGTACAAATGAAGCAACTGGAGCAGCTTGGAGCTACTGGCATTGTTGTTGCTTGAGGCACCACCACTTGGCAACAGCACT
TGAAGACGGTTGGCGTCGACCGTGAGCAGAAAGCGGAGGACCTCACTCACAATCAGACTCTGGAGTCGCGAGCTCGAACTGGAAGACGACGTGGCAGGAT
CCACGTGGCTCCACGCGAGGATCTTGGTGAAATCGAGCTTCACTTCGCTCATGACCTGCGGGAGGCACTCCAGGTACAGACGGAAGACCACGAGCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGATGAGCGCGACCTTGTCCACCGACGCGCACAACTTCAGCAGTAGCGACACGAGCGCCTCAGGACTCGGCAGC
AAGAAGCGGAGCTCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGCGTGACCTCCATGA
TCCCGAGCGTGCTGTAGATGATCAGGTTGTTGGTGTGCTGGATGCCGCGCGACAGCTCCTTGCGGCAGTTGATCGGCAAGATCAGTCGCGTCGCGAGCGT
CGACGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTTCGGAAGTCCAGGCTTCACGGCGTCGAGCGA
GCACGAGAGCAGTTTTTGCACGAGCGACGCGACGCAGAACCACCGGTACACAG