Description :
From Genome Similarity Track
Location :
Scaffold_440:7953- 10668
Transcript NameFunction/comments
Physo_145061reverse transcriptase

Sequence
2715 bases(100 bases per row)
CGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACGCCACGAGC
CTTGGATCGATTGGAGGTCGAAGACCCTTGGTGCTACGCACTTCTCTCCTGGCGGAGCATTGGCGAGTCATGAACCCACCTCTGCTAGGAAGCAGAAGCG
CTTCTGGCGCGAGCACTGGACCGAGTCGGTCAATGTGCTGGATATCGGAGTTTCCGAGTTGGTGGACACTGAGTGTGTCGAGAACGAGCGTTCCGAGCGT
GGCTCGCGGACGGCAGGTGGAGCGGCACGAATTCGGCTGAGCGGGTGTGCATCTGAGGGCGACGCCCTGCTGCGTGCCAGCGACGGCGCGGTCGGCGGGA
TGCCGAAGAACAAGGGGCTTTGCCCGAATGAAGATCGTGGAGTGGCACGTAATCCACTGAGTGGAGGTTGCGGATCGTGCAGCTCTTCGCTGAGTATCGG
TAAAGACACTGGAGCTCCCCTGGAGCTGAACGAGGTGGTGATACCTGGCGTCAAGACGCACGCGAAATCACGGAGCTCTTCAGGGCGGACGGTGTCCATG
AAGAGGAGGCAGCGCCGCAAAGCGCTGGCCGCGAGACGCAAGGCGTCTGCGATCTCACGAGTCGAGAAGGGCGTGTCGAGCGGTGAGGCTCCATGCGAGA
GCGAACAGCTCTATACACTCGTGAATGGAGTGACGGGCGACGTCGACGGAGGTATCAACCTCGACGACTTGCCCTCACTGTCTGCTCTCCTGGAGCTGGA
CGAGATGTCCTCGACCGAGTTCGGCGAAGCCTTGAAGGCTGGAGACTTGGCTAAGGTAGTGGTCATACGACTCGAAGAAGAATTGAACTCGTCCTCGCTT
CTGGATGAAGCTGTTCTGGAAAACACCAAGAAGGCGCTGAATGCGCGGAGCGGATCGGCGATCCTGAAGAACCCGTCGGATTCCCTGTATCAAGTGGTAA
AGGATTACCAGGACGTGGTCTCGAAGGAGCCGCCCTCGGGGCTACCTCCGGATCGAGCTGTTCGACACGAAATCGATCTCGTTCCCGGAACGAAGTACTG
CGTGACGAGGCAGTGGCCCTTGCCGAAGGAGCAGTGTGACGTCATTGACGCGTTCTTCCTTGCAAAGCACGAGGCGGGCATGGTGCGTGAGAGTACGTCT
CCACACTCTACGCCGACGTTATGTGTCAGAAAGCCGAATGGCAAGTGGCGTATCGTGCATGTTTTCAACAAGCTGATGCCGCTACCATTCCGGCGCAGAC
GCTGATTCCTCGGAAGGGTGTTCTTCAGAACAACATGACAGGATGTACGATGTACAGTGCGCTCGACTTGGTCGATGGATATTACCAATTGCTCATGAGG
ACGAGCGACATTCCTCTCACTGCGGTGAGTACTCGGAGCGGCATGCTCTGGGAGTGGTTGGTGATGCCCCAAGGGCTTTCGAACGCGCCAGCGACGTTTA
ATCGTCTTGTGACGCAGCTCTTCAGGCCCCATCGGGCATACGCGCAAACGTACTTCGATGACATCTTTGTCCACAGTCGTGCGGAGCACGGAAAGACTGA
TATGGAGAACCATGTGGAGCACCTGCGTGCTGTGCTCGAATGCATGCGTCAAAACAAGTTGTACGCCAACATTGACAAATGCATCTTCGGAGCGGAAGAG
ATCCCCTTCTTAGGGTGCTTCATCGGGAAGCGTGGCCTGAGGGCCGACCCGGTCAAGGTCAAGGCCATTGTTGACTGGCCGGTTCCCAAGAACCAGAAGG
ATCTTCGCAAGTGGCTTGGCATGGCCAATTACTTGCACAAGTACAGCGAGAACTACGCTGAGATGGCTCGGCCACTCTCCAATCTCCTGAAGAAGGATGC
GGAGTGGTGTTGGGA