Description :
From Genome Similarity Track
Location :
Scaffold_8:7951- 14753
Transcript NameFunction/comments
Phyag_g250hypothetical protein
Phyag_g251succinate semialdehyde dehydrogenase, mitochondrial precursor

Sequence
6802 bases(100 bases per row)
GACACTGCAGGGAGATCCGCGCCGCCCGGGCGACTTGCACCCGTTCGTGCGTGAGCAGGTGGACCCCGACGACGCCCCCGGCGACTGgtacgccttcttc
tcgctcatcCTGGGCTTCCTCGCCTTCACCATGAAGGTACGTATGTCTTTATTTCTTACTGTAGCAACGGCACTAATGCTCTCCTTGGTGTATACTTCGT
CAGTGGAAGGAGCTGGCTTGGGgctcactgctgctgtgcgtggGCTCGTTCACCAACATGAAGTCGCAGGACATGAACACGACGCAAGTGGCcatgtcct
tcttcttctccacctccgcccTCGTGTCCGCCTACATGGGCGCCATGCGTCCTGGGATGCCCATGCCATCGGCCCAGACGGTGGAAGCCCCCGCCTCGTA
GAGAGAATAGGGAAAGTATACTCAGCAGGGGTACAGGCATCTGCTGCATGCATGCTTACAAGAATCGGAGAAACTTTGGGTTTTGTCTTTACGTAGACTA
TAGCTGAAACGACCGGTGCTCATGCTATTTAGGACTGACACTTTGCTGCTAGGTAATGACGATCGGCCCTCGTGAAGGATACCCGGAGAGTTTTGGAGAA
CGAACAAAGGGGTCACCTAGACAAGACAGCGATGGCTACCAGAATGCCAAGCACGAAAGTAGCGGTGTGCTACctcagaagctgctgatgaagcGGCCGC
CGGGGCAACCACCTGCCAAGATACTTTCTCCACAGACGACTCGAGTCTTGCCGCCTATTACTCCAGCAAGTCCAAACAcacctgctgcgtcgtcgacgat
gactcttgaagagaagcagcagcgacagatGCACTCATTCCTGCGCAACTTTCTCGCTGCGGGTGAAAGCGGACGCTTCCAACAGGTGATCGACCTCCAT
CAGCATGGAATCGACACGGGAATCACTGTCACAGACGCGACGCTGCAAGAAGTGGTGGTCATGGTGCCCAACCTGCGCGGACTTAACCTCTCAGGATGCT
CACACATCACGGATGCTGGACTTTGGGCGGTGGCCAGGCATTGTCAGGCGCAATTGGACACCATCTATCTAGCTCAGTGTGAGAAGGTGACCGAGCTTGG
GTTGCGTCTTCTAGCGCATAATTGCAGGCTCGTATTGGTCGATCTCAGCGACTGCCCACAGCTCAATGACGCCGCACTGCAGACACTGGCTGCAGGCTGC
TGGATGATTGAGACCTTTATTATGAAGAGGTGTCGTGGGGTCTCCGATGCCGGTATCGTCAAAATTGCGCAATGCTGCAAAGATTTACGCCATTTGGATG
TTTCCGAGTGTTCTCGACTTGGTGAGTACGGCGACAAAGCGCTGCTTGAAATCGGAAAATGTTGCCCCAAGTTACGTGTGCTAGATCTCTTTGGGTGCCA
ACACGTGCACGACCCGGGTGTCCGCGCTGTTGCGAAAGGCTGTCCGCTATTGACCACACTCAAACTGACCGGGTGTCGAGATGTCAGCAGTGTCGCTATT
CGTGCATTAGCTCAACAGTGCACACAGCTTGAGATCCTATCACTTTCAGGATGCATCAAGACAACAAATAGTGACCTCGAACTGCTTGCTACCAACTGCC
CGCAACTTACATGGCTTGACATCAGCGGCAGCCCGAACATTGATGCCCGTGGTGTGCGTGCGCTAGCACAGAATTGCACTTCACTGACGTACCTGAGCTT
GGCTGGGTGTCAGCGTGTGGGTGATGCTGCGTTGGGTGAACTTACCCGCGCAGGTGTTGGCGGACTCACAAAGTCTTTAGGAGAGCTATCGCTGGAAGAT
TGTCCTCGCGTTACGGAAAATGGGGTCGATGCGCTGACTGCCGTGTGTCCCAACCTTATCACACTCAACCTCACCAATTGCAAGCAGATTGGCCGAAGAT
TTCTTCAGAGGCTCATCACAAAGCTTGTATTCGTGCAATGGGCCACGAGTTTCTTCGGGTACGAGCCGCTGCCAAACGCTGCTGAACTTTGCCGCCAGCG
TGATCTCCGTTTGTTAAAACTACGAAGTGCAATCAAAATTCAGTCTGCAATACGCGGGTGTCTTTCTCGCGGTGGACTCTGGCAGGCAAAACTCAAATTC
GTGGAGCGAAGGATACTGCCAAAAATCCAAGCGCGTGTGCGTGGATTCTTGGTGCGAAAGCGCCTCGCAGCTGAGAAGCGGTACCAGCTAGAAGACCATG
CTGCACAATTAATTGGGCGTGCTTATCGCGACTTGCAACTTCGGCGGATATTGGCACGAGCTAAACGACTGCGCCAAATCAAGgagcacgaagatgaagc
ggcCCTCATTTTCCAGAAGATTTTCCGTGGCTATCGTGACCGCAAGCTCATAGCGAAGATGCGATACGAAATCTACTGCGAGCAACAGTTCCAAGCTCGA
GTGTTAGCCATGCAGGACTTGGCAGCCACGAAATTGCAACGTGCCTACCGAGGGCATTGCGGACGGTCCGATGCAGCGATGTTGCGCTCAATTAAGGAGG
CGAATCGGCTTCAGCATGAGCGAGAGGTTCGTTCTGCATCGTTTCTCCAGCGAGTGTATCGGGGCCACAAAGGACGCAAAGTCCGTGCTCAACGACTTGC
CGAGTTACTCCATCAGCGACAGTGCCAACAGGGTGCCATCAACATGCAAAAAGTGTTCCGTGGTCACCAAGCGAGAAGACACGCAGTTATTTTGCGGGCT
GAGGCAAACGAACTGCGCATACTTAACGCTGCTCTAACCATTCAAAGATGTTGGCGAGGTATTCGCGACAAGCATTTGGCTGCTGTTCTGATCGGATTGA
TCAAGCTACGCGCCCGGGAGAACGAGGCAGCGCACTCGATCCAGGCAGCATACCGTATGCATGCCTCCCGAGGATTCATGAAAGCGATGAAGGTGGCTTT
AGCTGCACAGACAAGGCGGGtgaaagcagcaacagagaTCCAACGTGTAATTCGAGGAAGCCGTGGGCGAGCTGAGGCTGAGCTTcggcgagagctgcag
cggttCCGTCACCAAGCGAAGCCTTTGTTCGCGAAAGAAACCCGTTTACAGGCGGTTGTGGATGACTTGAATGATAAAGTGAACCAGCTACAGCAAaaag
ttgctgtcgatgaagacgaagagcgtGTGCTTAcactggagctcgagaaaACTCTTCAGATTAAGACGAAGTATCATGACTCGAGCCGAATCACCGGGAC
GCCGCAGCGCTATCTGACGCAGTACCTCCAAGTTCAGCTTGCAGACCAGCTACGAGCAAAGCGAACAGAGATTGCGCTTGATAGTCACGCCTTCGAGACA
TTGATGACAAATCTGAACGACGCTCAGAAGCAATTGAGAGGCGTTAGGCGAGAACTCGAACCACTAACCGAGGGTGTCATCAAGAAAACTCGTGAAAACC
GCGTAAAGAGATTACAGGATAAGGTTCGACACGAACGTCGAGCGGCTATCGCGATTCAGCGGATATTCCGTGGTTTCCGCGTAAGggaagctgttcgaga
gGGCGGAAATTGCTGGGTCCGAATGGTTTCTCCCGACGCTGCTCGACCTTATTTCTACAATGCACTGACAGGGGCTACGCGATGGCACCGACCGTTAGCA
ATGGACATTTTCGGGGACGAGTTTGCGGAGCCCATGAATGAATCTGCCGAAACATCAGCACAGCAACCTACAAacagccaccgcagcatCTCTGATCGAC
ATCGTATCAGTGGTGACAAACAGCAATCCGATCGAAGTAGTTGGTACGAAGCTTTCGACGACAAACTTCAGGCCTCGTATTACTTCAACAACCAAACCAA
GGAATACCAGTGGGATAAGCCCGACGCTATCGATAATGCATACTTCGCCGATAGTCAAACGTCTCGTAAGCGGAAGGAGTGGCTCGAAGAGCAGCTACAA
GACCTTGAAGGGCTGTTAGCTGCTACACAAGTTCGTTTGCCTCTGCTCGGCCAGTGGGAAAGGAGAGTCGACCCGCTTAGCGAGTACACTTTCTTCTACC
ATCCAGCGACAGGAAAGGTCAAGGCATCCCTATCACCAAGAAGTGTTCATGCATCGCTTGGCGACTCTGTATTGAACTCGCGCCGTTCTGCTCGTAGCAT
CAGAAGCTCTCGCTCTCTTCACTGGCAGTATCGATATGGGTACGAGTACGACGCTAGCGGCAAGCTTGTCACTAGTTCGAGATCTCAATCGCGTCCAATT
TGGACTGAGCACACCGATCCAGATAACGGCATGACGTACTACTACAACGTGCTTACCAACGAGTATCGATGGGAAAAACCTGACGACTTCGACATCAACT
ACGAGACGTTTGTTAGCGGTCGaagcgccagctcgtccgctCGTAAGTGGTTTGAGATGGCTCACCAAAAGGTTAATGACGATGGTAGCAGCTCTCTCAC
GACTAGATCGTCCAAATCGCGCACTCTTGGTATGAAGTGGGTCGAGTTGGTTGATCCAGAGACCCAGAACACGTATTACTACAATGAAGTGACAGGGGAG
TCGAGGTGGTCGCTTTCACCGCGCAGTGCTCGCGACACTTCGGACACAGAAAACCAGATCTCTCTAGCTCTGTTCTCTcaggtgaagcagctccgTGAAT
CTCCTACGCCATATTCATCACGAGACCAACATATGAGCTGGCTGGAAGCAGCCATCACTGAGAAGGACTGGAAAAAAGCTGATGCGATCGTCCAGCAGAT
TTTCATTCGAGAGCAGAGCCAAACAGTGACAGAGCGCAAGGCTAGAGAGGAGGAAGCGAGAACTTCTGCTTGGTCAAGCGGAGAGGTGGAGAGCTCAAGT
GCTTGGATCGAGTGCAGAGACGAAAGTAGCGGCGCCACGTACTACTACAACCAGGAAACAGGGGAGACAAGCTGGAGCAAGCCTTCAACAGCGGCTAACA
GCATGGGCCAAAGCGTAACTGGTCAATGGGAAATGATGCaggacagcgacggcaggGCGTACTACTACAACACACTGACAGGAGAGACATCATCTTAGTC
ATCGCCAACATGACACCACCAACTTGTGGCAAAACAAGAGTATCTCTCAGGAACGATAAGTTTATTCCACAACACTGGTACACATGACGTGGCATCTCAT
ACCTCTAGTCCGCCCACGCAGACCATCTTGGTCTCCTGGTATTCCTCCAGACCCATGAACGAACCCTCACGTCCCAGTCCGGACTGCTTCACACCGCCAA
ACGGAGCCTGCACATTCGAGATTGCACCCGTGTTCACGCCGATCATGCCACagtcaagcgcagcagcaacgcgccaCGTACGAGAAAGGTTCTGCGAGAA
GAAGTATCCGGCAAGACCAGCCTCCGTGCCGTTGGCCATCTCGATCACCTCCTCTTCAGTAGAAAACTTGAACAGCGGCACAACCGGTCCGAAGATCTCC
TCGCTCCACACACGCATCGTGTTGTCAACGTGAGCCAGCACCGTGGCCTCGTAGAAGTTGCGTCCAATGTCGCTGCGTTTGCCGCCAACCAGAGCCGTCG
CGCCGTTCGTGACAGCATCTTCGACCAGCTCCGACGTCTTCAGGAAAGCGTTGGGGCCAATCAGCGGGCCAAGGTTCACGCCATCCTCGCGAGGCGGAcc
catcttgagcttcttcacgcgctccacgagcttggcCGCGAACTCATCGTAGATGTTGgcgtggatgaagatgcgGTTGCTGCACACGCACGTCTGGCCC
GTGTTGCGGAACTTGGAGGCCATCAGACCATCCAGAGCTTTGTCAAGATCGGCGTCGTCGAATACAATGAACGGAGCGTTTCCGCCAAGCTCGAGGGACA
CGCGCTTCACCGTCTCGGCCGACTGctccatcagcagcttcccgACGCGAGTGGAGCCTGTGAACGAGATCTTGCGGACGTCGTGGCTGTTCGTGAGAGC
TCCTCCGACCTCTCCCGCCTTGTCATTGGGGGCCGGCACCACATTGATGACGCCTGGTGGGATGCCAACGTCTTCCGCCAAtttggccagcgccaaggCC
GACAGCGGCGTCTCGGCCGCAGGCTTGACGACTGCAGTGCACCCAGCCGCCAGACACGGGCCCAGCTTGCGCGTAATCATTGCCAGAGGAAAGTTCCAGG
GCGTCACGATGCCGCAGACGCCCACGGGCTCCTTGAAGGCCATGATCTTGTGGTCGGGCGCCGACGTGGAGGGCAGGAAGCCGCTCGAGTGCATGATCTC
GTGCGCGTAGAAGTCGATAAAGCCGGCAGCATAGGCCACTTCGCCCTTGGCCTCGGGCAGTGGCTTGCCGCTCTCCACGGACGCGATGACGGCCAGATCT
TCCGTgttggcgacgatggcggcgtgccacttcttgagcagcaccgagcGGGCGGCGGGGGTGGTCTTGCGCCACTTCTTCTGGGCCGCCAAGGCTGCGG
CGATGGCCTCGTTGGTCTCCTGGCGGCCCATGTTGGCCACGCGCGCGATCTCCTTGTCGGTGGACGGGTCGATGACTGCGAAGTGTTTGTTGGAGTGCGC
CTCGACCCACTTGCCGTTGATGAAGCCGGCCGACTGGACGAGCTCCTTGTTGTGCACCTCGGCGTGGAAGAAGCGGcgcgaggcggcggcggcggcgggc
AGCACGGAGCGGTGGATCTTGGACGACAGCATGGCTTGAGCTCGACGAGGCAAATTCGAGAATGAGCCGATGCGCGGGTGTTGAGCATTTCGATACATAC
CCCCGGACAGTTGACTTGGTCTTTGTATGGGTTGTACGGGTACGTCAGCGACGCGTACGCTCCCACGTTTTGCCCGTTGCTGTCCTCCGCAGGCGGCCAA
TG