Description :
From Genome Similarity Track
Location :
Scaffold_103:79497- 81185
Transcript NameFunction/comments
g13093.t1hypothetical protein

Sequence
1688 bases(100 bases per row)
CGTGGCTGCGTTGTACAGCGCCCATGATCGGGAGAGCCCGTCGTCCATGGTCGCGTTCTTGAGCTTGTGCAGCGAGTCCACCGGGTCGACGGTCGCCGCG
TTCACAAGCAGCAGCGACAGCCACGTGTTGTTGCTGTTCTTCATGGTCACGATCTTTTCCTTGGACAATATGTCGTTCCACTCCTGCTCCACGAACGTCG
AGGTGCGGGCCAACTCGTTGATCGGAGACACTGGGATCATCTGAATGCCGTGAATCGCGTACTTCTCGTCCAGGAACCACGTGTTGTAGTAGACCTTGTT
GTCGAAGAAGATGCCCGTGACATGGTTGCGCACGATCGCTGGCGGGTGAATGGTGTTGTCCGACTGTAACAGGAAGTACGTTCGGATGGCGTGCGCGTTC
AGGCGCAGCATGAGGCTGCCGAGGTCTTCCACTGCCTTGTGGCCGGTCACTTTGCCCCATAGCGTCATACCGTAGTAGAAGTTGACGTCTTCGGACGTGC
TCTCTTCGTCCTTGCCATGGTCTAGTAGCGTCACACCACGCGAATATGAGTGGCCGTGGTACCAGGAAAAATGGCGGAATCTTGGAAAGTAATGATCTTC
AAGACTCGGGTTCGCGACATCACGCAGCATCGTCCAAATGATAGTTTCCAACTCCGGCATACGAGACCAGTTCGGGTCCAGGTGCTTGAGAATGGCCGAC
GCCGTCACGAAGTAGCCGAAGTGGTAGTGGTGGTCGTTGTAGATGCCGCTGCCGAAGTCCATGTACAGCCAACCAGTTTTGAAAATTAAACTGGAGACGA
CTCCACGGTAGAGCGTCTCGTATACAAGGGGTGGGGACAGTGTGTTGTTCAGCATTGGTTCAATCAACGTCTCCAGCTTCTCCAGGCAGTACGACAGCAA
CGTTGTGTCTGGGCCCACCACCGAGCTGTCGGCTGCCATCAGACACAGCGACGCGTACTTCTGGAAGTACTTGCCATTGTAGTACCAGCTATCAGCGTCC
AATTTCCAGTCTGCGATGATATCCTTCTGCAGTGTCCTTAGCATATCTGTTTCAAGGACCACCCAAGGCGATGGTTTTTTCGCCGGATAGAAGTCCACCT
CGAAGTCTGCTTCCGGCTCCACAAACGTCCAAGTTGTCGAAATCTGGCCGATCATTTTTCCACGGGTAGTAGAGTGCATCACGATAGCACCCTGACTGCC
CGCCGTCGTCGGAGACCCGCTCAGCGATTCCACCTGGTGTGGTAGTGCGAAGTGAAGCAGACCCACCGTGTCACAGGTGTTGCCTTCGGTGGCCCAGTGC
AGCGAGTACCCCGTGCGCGACTCCATCGACACACTACCTCCGAGCACCATACACGATGCAAACTCGTCGTACACGGTGTCGTCAGCATCATCAGGGAGCA
AAGCCACTCGGATGGTGCCAGAATACCCAGCGTCCGCGACCAGCGATGAACCCGACGCGTTCACCGAGAACACGACCGAGTCCTCCACACGGAACGAGAT
ACTCTTGTCGCTCGCGTACAGCACCCACGTCTGGCTGTTGTTGAGGTGGATGACGAACTTGCCCGGCGCCGAGTCGTCCACGGCTGTGATATCGTGTTCG
GTGTCGATGCGCGGGGTGAGTCCGTCGTACTTGGCCGATACAAACGCCATGCCGCTCACAAGCGCAGAGTCCATGCATTTGCCGCTGG