Description :
From Genome Similarity Track
Location :
Scaffold_22:79490- 81027
Transcript NameFunction/comments
Physo_248056Hypothetical protein

Sequence
1537 bases(100 bases per row)
CCGTTGACTTCGAGGACGGCGTCGTGGAGATGGAAGAAGGCGAGGCCTCTTCTAGCAAGCGCAAGGAGTCTATCGACAGCGATAGTCTCGACCCGCATGC
CGGGTCGAGACGCGCTAGTGAAGGAGACGACTCGGACGCTCCGAGCTCGAAGCGTTCGCGCGGCGAGAAAGAAACTCCGCTCTCTGCTGCTGGGGCTTTA
AGCTCCCCGTGTGAGGTGGCGACTTCAAGCTCTCCGCGCGCTGCCAAGGCAGCGAACGATCCGTGGATGCCGTCTGCGTCAGAGATCGCAGACCGTGTTG
GCAACACTATGCCTCCAAACGAAATCCCGCTGTACGTATGCAGCGGGATCCACGACGATGCTGTTGCGGAGGAGCAGCACTTTGATCCGTTAACGAATCA
AAGGCGCGATTATTATATCGGGCTCTTCCACGAGCTCCGATACTTCTCCAGCAAGAAAACTTCTTCTCGCAGCAAAGTGCCTGAGTGGCAGGCACTTTGT
CAAAGTTGGAACGCTTTTGTTGAGAACTTCAACAAGAAACCGGCTGCTTACCGCGAGCGGGTTAAGCATGCCCGTGAACGCTTCGAGACATTCTCGACGC
ACGGGCGGCTGGAGCAGCTCCACAGATCCTCTGTGGACGCTGGTATTCCGTGCGCTGTGCCCGAAGGCCAACAGTGCACGTTGTGTCTTCCGGGTGCGGT
GCGCTTGAGCGACCGCGACCTAAACGGGTACACGACGATTCGTGTACCTGCGAGCATCAAGGAGCTCCGTGCCAAGTTCTTGGCACGCGAATAATGCGAC
AACCGTGGGACTTCGGGCGCTGTAGGTGACCACAGCGCTCGCACTACCTTCGCGTCGGCAGTGCGTGGTGAGCTCCGTACTCCCTCACCATTTCCGGAAC
GTCCTACAGCAGGACGTCCCGCGGCTCCCATGTATCTTGGTGGGGCGGAAACCCTCTCCAACGAATACGATAACGAACCGGCTGCCGGTTCGTTTTCGGG
ATACTATGGTTCACAATACACTCAACAATCTAGCGTGTTGAGCCGCGGGCGTCGCGGATCGGAGGCGGCGGTGGTGGGAACACGTCACGGGTATGGTCAA
CCTGGGGTTGACCTTGGTCCGACGCTCGAGGATCGGGTCGCTGCAGTGGAGCAGCATCAGAGCCGGGAGTTCGCCGCTCTGAAGCAGGAGGTGGCGATCC
TGAGGGCTCAAGTCGCTCAGGGCTCGCAGACCGCGTCGGACATCTCTGTCGACGTGGGAGGTCGCGTCGTGCGCTTGGCCCAGCGCGTTCACGCGCTGGA
GCAGAGGTTCGCTCCCGCCGGGGCTTCCGCTTCGGGCCAGCCGAGCTAGGTGGCTTGTGCTGCCGGTATGGCTTCAGCCGCCCGACGTAAAAGGTCGGAT
GGAGGCGCATGCTAGATGGAATATCTAGCGTGTAGGCGTTGCCATGCCGTGTTAACACCGTGAACGGCCCGATGAAGCGCGGAGCGAGCTTGCTCGCCCC
GAAGTCGGAAACTGCATGCTTAGGCAGGTTTTGAGTA