Description :
From Genome Similarity Track
Location :
Scaffold_17:7946- 12467
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_17-snap-gene-0.23Hypothetical leucine rich repeat calmodulin binding protein
Pytap_DAOMBR444maker-pag1_scaffold_17-snap-gene-0.37Succinate semialdehyde dehydrogenase, mitochondrial

Sequence
4521 bases(100 bases per row)
CATGACACTGCTCTGTCTGTGGAAGAGTGGCAGTCGCGCCAAATGCGCTCGTTCCTGCAGAACTTCCTCTCTGATGAGCGTGGCCGTTTCCACGACGTGC
TTGACcTCCATCAGCATGCTATTGACACAGGCATCACAGTGACGGATGCGACGCTGCAAGAAGTCGTGACCACGGTGCCAGAGTTGCGTGGGCTGCGTCT
CACGGCGTGCTCCGCCATCACTGATGCTGGCATTTGGGCGATCGCACGTCAGTGTGCGTGTCTCGATACCATCTATCTGGATGGATGCGACCGAATCACA
GACCTTGGGCTGCGTTTGCTTGTTCACAACTGCCGGCTCGTGATCGTAGACCTGAGTGACTGCCCCCAAGTCACAGACTCGGTGCTTCAGACGCTAGCGG
CGGGGTGTTGGATGCTCCAGACGTTCATCATCAAGCGCAGCAATCGTATCAGCGACGCGGGCATCGTTAAGATCGCACAGTGCTGCAAGGACCTGCGGTA
TCTCGACGTGTCTGAGTGTGAACACGTTGGAGAGTATGGCGATAAGGCACTGATCGAGATTGGCAAGTACTGCGCCCAGTTACGCGTTTTGGATCTCTTC
GGCTGTCGCCACGTGCAGGACCTTGGTGTCAAGGCGATTGCTAAGGGATGTCCAATGCTCACCACGCTGCGACTCACAGGCTGCCATGGTGTGAGTAGTG
GGGCATTGCAGGCACTAGCGAAGCAGTGCCATGAGCTCGAAGTGCTCTCTCTCGCTGGCTGCGTGAAGACGACGAACGAGGACTTGGCGGCTCTCACGCA
CAGCAACCCTCGGATCTACTGGCTAGATGTTAGTGGAAGCCCCTTGATCGATGTCTCTGGCATACGAGCGCTGGCCGTCAACTGCCCTCGGCTGTCATAT
CTCAACATCTCATTCTGCTATCGCATCAACGACGCCGCACTGCTCGAGCTGGGGgCTGACATGGCCGCTATCCGGCAGGCGTTATCGCATCTTGTGGTCA
CCAACTGTCCTCGCATCTCGGAACGCGGCGTACACGCCCTCACGGATGCATGTCCAAATCTATTGACGATGAATATGACGTATTGCGAGCAGATCGGACG
CCGTTTCCTACAGAGACTGGTGCAGAAGCTCGAATTCGTCGAGTGGGCGAGCAACTTCTTTGGCTTTCAGCCACTTCCGAATGCAGCCGAACTGTGTCGT
GCACGGGATCAACGGCTATTGGAAGAACGCAGCGCCGTGCGCATCCAGGCATTAATGCGAGGCTGCCTCGCACGAGGTGGTGTATGGCAAGCGAAGCTAC
GCTACGTGGAGAGGAAGTGGTTGCCTCGAATTCAAGGACGGATTCGTGGCTTCTTAACTCGAAAACGCCTCCGAGCTGAAGCCTACGAACGCAAGAAGCG
AGCAGCAGCGATGTTGATCGTCCACCATTATCGAAACTGGAAACTTCGGCGGTTGCTTGCTCGCCATCGACGGCTGCTTCGTATCCGAGCGAATGAGGAA
GCCGCAGCTCTCATTTtCCAGAAGATCTTTCGGGGCTATCAGGATCGCAAGCGAGTGCGTGCGATGCGAGACGAGCTAATGCGTCAGAAGTTGTTCGCAG
CCCGTGAGCAGaCAATGCTGGAGCTGGCCGCCGTCAAAGTCCAGCGAGCGTATAGAGGCCACAAAGGACGTGGCGATGCTGCAGTCTTACGTGCTGCGCG
AGAAGCGAATCGAAGGCAAATAGAAAGAGAAAACCGATCAGCCATGTTCCTCCAACGCGTGTACCGTGGTCACCAGGGCAGGAGGCGTCGCGCTGCTCGC
CTAGCAGAGCTACTTCTGATGAAGAAGCAGCAagAAGGGGCAGTGAAGATGCAGAAGGTTTTCAGAGGCCACAGAGGTCGTCGAAATGCTCAGTTACTAC
GGGTTGAGGTGGAGCAGCTTCGCCGCTTTGATGCCGCGTTGACTATTCAACGCCGCTGGAGAGGACTCAAGGAAAAaCACTTGGCGTCCGTACTCATCGG
GCTTGTCAAGCTCCGCGCAAGAGAGCAAGACGCAGCCCACGCAATCCAACGAGCATACCGCATACATGCATCCCGTGGCTTCATGAAGGCAATGCGACTT
GCACAGCAGCTCCAACGACGCCGTCTCCACGGAGCGATTGCAATCCAACGCGTCTTGAGAGGTCATCGTGCACGTGGCGAAGTGGAAGTGCAGCGAGGGC
TGAAGAAGTTGGAAGTCGTAGCAAGGCCGTTCTTTGAGAAGAGAGAGCGATTCCAGAGTCTCGTGGATGAGCTCGGCTCGAAGGTACAACGTTTGCAGGA
AAAAGTGACGAGCGATGAAGAAGATGAGGCCATGCTGGCAGTGGAGCTCGAGAAAACGATGCAAATCAAGACGAAGTACCAcGATTCGagCCgCATCACG
GGTACACCACAAAGGTATCTAACACAATACCTTCAAGTACAGCTGGCTGACCAATTGCGTGCAAAACGaGTTGAACTGGCAATGGAAAACCGAGCGTTGG
AGACACTGCTGACGCAGTGgAATGAGgCTCAGAAaCaGCTCCGCGCAGTCTTGCGCGAGTTGGAACCaCTCACAGTCGGAGTCGTCATCCAAACCAAaGC
GAACCGGACACGACGATTGCAATTGAAAGTACGTCGGGAGCGAGTAGCAGCGACCAACATCCAACGCATGTTCAGAGGATATCGCGCTCGTTGTGCTGTG
CGCGAAGGTGCCAACTGCTGGATTCGACTGCCATTAGATGGTGGACAGCCCAAGAAACGAGGAGAACCGGCAAGTCCTGCCTTCTACTATTACAACACAT
TCACAGGCGAGTCACGATGGCAGAAGCCACTCGCGATGACGATTTTCCAGGACGAGTTCCTGCAGCCCATGACGATGGCACTAACAAATGGTACTGTTCC
TCTTGCCGTGAGACAATCAGCTGCTTCGCAGTCCTCGAACTGGTATGAGGCATATGATGATCGCGTCGGCCAGGCGTACTACTTCAACGCCGTGACCAAG
GAATTCCAGTGGGAAAAACCGGAGTCCACGGCGGTCTCATACCAGACAGATACGCAGACATCTCGAAAGCGCCGCGAATGGCTGTCCGAACAGCAAGAAG
ATGGAGATATTCAGCAGTTGATTGATAACGCCGAGCTGCGGGGACAACTGGGAGAGTGGGAACACCGAGTCGACCcGCTGTGTGAGTTCGCCTTCTTTtA
CCACGCACCGAGTGGCGAATTGCGAGCATCGTTATCTCCGCGCTCGGTCCACCAGACACTCCAAAGCACATCTTCTTCTTCGTCAGGACGACGCACTGCT
CGCAGCGTACGGACGACGTCTCCACGACCGaTGCTGTGGCAGTACCAATATGGATATGAGTACGACAGCGAAGGGCAACTCGTTCCAGTGGATGCCAATC
AACGTGATGACCGTCCTATCTGGACAGAGCATGTGGATGAAACGAGTGGGTTACCCTACTATTACAATCATATCACAGCGGAATATCGTTGGGAGAAGCC
ACAAGAGTTTGGGTTGGCTTTTGAAGCGTACACCAGTATGACCAACTCGTCCAGAGAGTGGTTCAAAGCACAGCAAAAaGACATACAGGAGTCTTCGGGG
gTTGCAACACCCAAGGCGGGCTCCTCACGGGCCAATTCTGGCCGCTTACTCACTGAACGATCGACCAAGACGCGGACGCTAGGCAAGAAGTGGGTGGAAT
GTGTCGACCCCGACAGTGGCTTCACCTACTACTACAACGAGATCTCAGGCGAGACTCGGTGGTCGTTATCACCACGAAGTGCCCGCGATGAGACCGATGT
GCCTGGACAGATGCCATTGGCTTTGTACGATCAAGTCACACAATTGCGCACGACTCCGGTGTTGTACTCTGCTCGAGAGACACACATGAGCTGGTTAGAA
GAAGCCATTCAACAGAGTGACTGGAGTAAAGTGGACGTGCTTGTGCACCAGATCCAAATCCGCGAACACAGCAAGATCGTCGAAGATAAAAAGATGGCAG
CGGCCGAGGTTGCACTACCACCCGGTTGGTCTCAGTACGAGGATCCGACCTCGGCCATGACCTACTTCTACAACGCTATCACGGGAgAGACCCGGTGGgA
CCGACCACAGTAGACACGATGCATTCATTCGACGCGCACGAATTCCTCCAGCCTAAACTTCCtGGCCTTCACGACATCAGCCCGCCCATGTTGACGAGCT
TCGTCTCCACATACTCCTCCAGTCCCATGATAGAGCCCTcACGTCCTAGACCTGACTGCTTCACACCTCCGAACGGTGCCTGTGCATTCGAAACCGAGCT
ACTGTTCACACCCACcATACCAACTTCAAGTTCACTTGCAACCCGCCATGCCCGTCcAAGGTCTCGCGTGTAGAAATATCCAGCGAGCCCAACGGGGGAG
TCGTTCGCCATGCTGATGACTTCGGGCTCCGCGTTGAATGGAAAGAGCGGCACAACCGGTCCGAAAATCTCCTCGTGGAACACGCGCATACGCTCGTCGA
CATCGACAAGCACGGTCGGCT