Description :
From Genome Similarity Track
Location :
contig_22:794483- 795877
Transcript NameFunction/comments
g6041.t1ETI51786.1 hypothetical protein F443_04963 [Phytophthora parasitica P1569

Sequence
1394 bases(100 bases per row)
AGCCCACCTACATCCTGTACACTAGCGCCTTGCTCGCTTTCGTGCTGCCGCTCCAGTACGGTTGGTCGACCTCGCAGCTCAACCTGCACAAGTTTAACAA
CGTTGAGGATTGCAACGCCCGTCCGGTTGCCGAAGACACGTGCATCATGTTTCCAGGACACACCAAGTTCCAGTGGACTATCGTCGTGAACGCGTGGATT
TTTGGAGGTATGATCGGTGCCGGTCTCGTCGGCAAGTTCGCCGACAAATTCGGTCGCAAGCAGGTCCTCATCTACAACTGCGGCTTCATCATTGCCGGTG
CTATTATTATGGCTGTCGTGTCGAACCTGTGGGTTCGCAGTCGGCCGTCTGCTTGCCGGTATCGCGTCAGGCGCTACGACGGGCAACGTTGGCGGCTACA
TCAACGAGATCTCCCCGCCTCACCTCCGCTCGCTGCTTGGTGCCGTTCTCCACAGTGGTATCACTGTCGGCATTCTGTTGGTTGCGACGACGTTCTTCTA
CATGGACTTCGACAACGGTTGGCGCTACATTGCTGCCTTCCCGATCGTGCTTGCGGCTATTTTCTGAGCATGTCCCCGTTCTTGATGGTGGAGTCGCCCG
TGTGGCTCCTGCTGAAGGGCCGTCGCGCGGAAGCCGAAGCTGTACTAACGCGTCTGTTTGGCGCTGAGAACGTGCCTGTGGCTCTCGAGTGGATCGAGTC
GAAGCGCAAGCACGATATGGAGATGCAGTCGAGCACGTGGAGCGAGACGGGCAACGAGGTTGTTCGCAGTGGAAAGGGTGTGCCTTTTCGGAGCTGATCG
CTCCCCCTCTTCGTCGCCAGTTCATCATTGCCATTGGTGTTGCTTGCATGCAAAAGATCACGGGTATCAACACGGTGTTCTACTACTCGTCGGATCTGTT
TAACCAGGCTGGTCTGAGCAACGCTCGTGTCAGTACCATCATTATCGACATCGTGAACATGCTGCCGACGCTGGTGTCGGGCTTCTTCGCGGCACGTTTC
GGAAACCGCCGTATGCTGCTGTGTGGTCTTGCTGGCATGTTCGTGAGTGCCATCGGTGTGACGCTTTCACTGTCGTTCAGCTGGTCGGCATTGTCGATTC
TGTTCATTGCCACGTATGTGGGTTCGTTCGGCGTGAGTCTCGGGCCGCTCATGTATGTGGTCATCGCGGATATCTTCCCCGACTACGCTCGTGCGACTGT
GACTTCTATTGGTGTCATGGTTGCCTGGACGGCCAACCTGATCGTGGGCGTTGGATACCCGTACATTTCGAGCGCGCTGGACGACCTCGCGTACCTTCCG
TTCGTAGTGCTGCTGGCGATTTCGTTCGTGTTCGTGCTCGCCCTGCTCCCGGAGACGTCTGGCAAGACGAACGAGGAGATCCAGGACGAGTTCC