Description :
From Genome Similarity Track
Location :
Scaffold_5:794475- 822231
Transcript NameFunction/comments
Phypa_INRA-310PPTG_04584hypothetical protein

Sequence
27756 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTCTATGTCGGGTCATTTTGGCGGCTTTGTATGAT
ATCGTCGCTCAATACTTCGTATAAAAAAGTAATGAGGAACGGGAAAAGATTCTGGGCAATGTGTCCCAAATCACGCTGCAATAGAACACATCTCCGAGGG
TACACGATGATGCTGAGCTTGGCTTCCGTAATTACCGCATCCATTTACTCCACCTCATATTGTTTGGTTGCATACCGCATCGCCCCTGTCCTAAGCGAAG
TTTTCTCCTTCGCAAACTCCGTCTACGACCAATGGCAGAGCTGTACCTTAAACAGATGGCCGCAGGTAAAATACCATGCCAGCGAACTAATTATAGACTG
ATTTCAAGCCTGGCACTTCAAAATACAACAGGAACAGTGGGAGCGGATAAAATACCAGAGCCGTCACCCTGGGTGAGACATATTGATATAATCGCCAATT
TTGTCAATTGCTCTCTCCTGGAAGTATTGGATTAGATAAATCTAGGACAGCCAATAGTGACGCTGCATACATGCCAACTAGCCCTGACGACGATCCTCTT
ACATGAATACACTAAAAGGAATAAGCCAGCATTACAATTCCGATCCCTATAATTTCCTTATCATTGGGCGTTGGGCTAACTCTTACTTTTTAGCGTCTTA
TTATGAGGTTTGCTAGCAATCCTCTGTGTAAACACGAAATATGAGTATTCGGTTAGGACCGGGGCGATGCGATACTGCAATAAAATCCTTTGTAAAAGCC
TCGTCAGAGCTACATTCGAACTCGGAGTAACCATTTCTAGGTAGAGCGTTATAAAATTCCAGCATTCTTCCTGGTCTGCAGAAAAAGTAAAGCCGTTTGG
GAACTGGCTCTGGCAGTGCATGATTTTGTACGCAGATGCTGCGATTGCGCGTATGCATAGGAAATGTATTGCATGTACCGTACAATTCTTTGAAACTGCT
GTCGTCTTAACGTTAAAAGACCCGAATAATTCGTGGAACCGCTATGGCAGACTGGCTGAAAAGAGGCTCTATAACGGTGGACTTCATGACTTTACGCTAA
ATAACCAAAAAGCTTTAGTGGTAAGTCCCTCTATTACTGGTGGGACCAGGGGCGTGCGGTGGTGTCCGCATTAGCCATGACTCTTCAATGGAGAGAACGT
TTTGGAAGACTTCACTACAGTAGCGATGACAGACTGGAGAATTCCCCAGTTGAGCCGCAGTTCCTGGTGGCGGTGTAGTAAAAAGCGAAGGTGCGCTCCC
ATGACCCTTCTGGTTCCTGAGCAGCCTGTGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCTTTGCTGGATTTCTTCGGATGTA
CTGTACAGCTGTGACTTTTTACATAGTTAAGCACCCCAGAATAGGAATATTTGACTTCAAATGTATTCCATTTTACGATTGAGGGGTGAGCGGGAATAAG
ATATTGGCTTTGAATGTGACTGGTCTCTAATTTATTGCTGTTGAGGGAGTATTCCATTCTAGGGATTACCACCGAGGGGATCGTCTGTATGAAATTCATT
ATATCTGTCAGCTGCTACAGAATCCCAAAGATCGGAATAATTCTGGACACTATTCCGAGATAGTACATTCAAATCATTTGCAAGGAAGCACAGCAGAATC
TGCTGGTGCTGCTTCTGATCACAATGGCAAACCACCGAGGAATTATCTTATCCGAGTGGAAATCCACTCGGATTGTATCGGAGGAGCCACTTGATGTTCG
TAAATTAAAACGGATTTAAAAAAACATTTATTATGAAAGTTGAACATTCGTTTAAAAAAAACATTATAAATAGCAATACACAACGTCCGCAACCTCTTCG
GTGTATTCATAGCTATGCATTACAGGCATGTGCAAGGCGTGAAACCCTTTAAAGACGGCCTCTCTGCTATCGACATCGATCACTGTATTTTCATGGGAAA
AAAGAAGTCGAAGACACCGGTCACGTACGGCTCCGTTCCGTTTGTGCTAGACGCTTCGGACCTATCAACAGCTAAAGGGCTCGAATTGCTTCGGGATGAC
ATACCTCTCAACACTACCGACTTCCGTGTACCTGAATACGGCATAGCTTACGAAAAAAAACGCAACACTGGGGCGGACACGTATGCGTCACAACAAGCAG
TCCAGCAGCGCTGCAAAGAGTTTGCATTAGTCTGTGGCTTCCTGGAATCGTACCTTTTATCGATGGTGACCAAAAACCCTGGATCTCTGATGCATTTTGA
GAAGTACTTCGACGGGACGTTTCATCGAGCTTGCTTCATGCCTAGTATTGGTGCCCAAATTGCCAAGTTTTCAAGGCGAATGCACGGTTTCGATGGAGCC
CACTTAAAAGGAGAAATGAATGGATACGGAGTCTACCTTGTTGCTACTTGCAAAGATTATCAGAAGCGGGTTACCCCGTTGGCATTTGAACTGGTTACGG
TGGAGAACTATGACAACTGGCGTTGGTTTTTAAGCCCAGTTCGAGCGGCGCATGGAGATTTAGAGATTTTCACTGCGGTATCCGATCGGGACAAAGGATT
ACTGAGCGCAGTTTCTGAAATCTTTCCTAAGCAGTTTCTGAAATCTTTCCTAAAAAAAGCAGACCACCGATTCTGTTTGGAACACATCAAGAGAAATATT
TGCAGTAAAAAGATACAATTAACCCCTTCCGAGAGAGGTTTAATATCTGATATGGCGGACAGCGACTGCGAGAGCGATTTTTTCCTCTATCGCACAGAAC
TGGCAAGTACCAACGTTCGAGCAGCAGAATATTTCGATGGAATTGAAAAGATTCACTGGGTTAAGTACGCCTACCTAGACCGATTTCACGTACCGACCTA
CAGTGAAGCTACCTCCAACTTGTCCGAACAAGCAAATAACTGGAACGGAAATGAATGCCGCAGCGCAAAGCCTTTCGATGCTTTCAATTTGTACTTTATG
AAATTGAGTGAGCGTGTCTCGATGATGCGACAAGATGCGGCAAAATGGATTACTGCTTATGGCGAAGACGAACTAGTGCCTTTCCTACAAGAACGACGAA
ATCAACTTACTGCAGCTTTCAACTACTGTCAGGTAACGCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTATTCT
GGATTTTATATCCAGAGTCCTATCCAGGATTGTAACGGCGCTGTATTCCTTTGATTACTAACCGAGCGCCGCCGCAACGAGGTGGTAATTTATTTTACGT
ATCAGTTGCTCAGGCTTTTACCGCCCTCGGCGGGGTTATTCCCCTTTTTAAACCACCATTTTTTTATCGATTACCCTTAAATATTCTATTTAACGCACTT
ACCGACTACTTTTAAATATTTCATTTAACCCTACATACTATAACAATATTTTTCAAGTCTAAATCTCAAGTTGGTCGGTGCGATCCGTAGGTTTAATGAG
CTTTGTACTATCGTAGCCTCCTGCGTATAACTATACCAACACGTTAAAAAAAAATGTTTTACATTCTTTGTATTATACACTTTATTTACAAATATTTAGT
GATAGTCTCGTGCCCTAAGCCTATTAACAAACGTTTTATTGTTTATATATTCACTACTTTATGATCTTGCACTGTGGAGTCTGGAGTGATTCCTCAGTTA
GTTGTATTGTTCGAACACCACTCCACCAAAATGAATATATTTACTTGTATTTGTTTTACATGTTAGTATCGTTGTTTCAAGTCACCCACCGCTCATGTTG
AACTACTCCCAAATAGCTGTGTTAAACAGCAGCGCAGACGTGTTTCAGCAACTGGCTTTGTGCTATATGGTCAAGTCTATCGGTCTCAATCATAATGCTT
CAGATTATTAAAACTCGTCGTATCCACTCTCTGTTCGCTATCACAGCTATTGTAAACAAAATTCATATTCTAACAATTTAAAAATGTTATTGTAATTACT
AAAATAGCATGCATTTAATCTTGTTGCGAAATAAACCAGATGTTCGAGGCCATACGCCATACGAATAACGATCTGTCGTACGGAGAATTAGTGCGAATAT
TTTTTTTTTTTTGGGAGGGGGGGGGGATAATATCCTAGTTCTTGCTGTGGACGTCTGCCAAAAATACTGTAAGCACCAACCATATCCGCAGCAGATTTGC
CACACAATATGACGACATAAGGCTGCTAAGACGTAAAACTCGTCTCAATAAGAACCCCGTTGACTCATTCATATTTCTTGTACCCAGCTTAAACGCTACA
CTACAAAATTGTAAAGTTTAATCTCACTATCCCTCCTCTGCAACGACCGTCACTCTGTAGTGACATAAATATTTTCTGTGACGTCGGGAGGCAACGCTCA
GTCTTGATTCTTCCTCTAAAAAGACAGGTGGGTGAAACACAGACTTTAAAGCGGTTTTCATGCGTGTATCTGACAAACCCTTATCCTAGCAGATGTGGTT
CAACTTGTTCACTCAGTGCTTCCAAGGCTGCGCTCGACCCGTTCCAACGACACCTTCGTGCCGGCACCCCCACTAAGTTGCGCATCTCTGGGAACAATTC
AACCCGCTAGCTACGGTCTTCCCCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGCAGCATAGCAGATTGTCTCCGTGGCGAAGACTACATGTAACCAGCCGTTGTACATGGCATTCTGGAGGACTGCGCTGGATGG
CTGCATCACCTGGAAGTAAAATGATAAAAATTAGATGACAATACAGATTTTCCTGGCCAACGTAATTACCCACCCGGAGATTTTTTCCGTCAATAAATTC
AAACGTGTGCTTCAGCAGCGGCTCTCGGGCATCTACCAGTCGGGTCAGCTCAATTTGTCGGGACGGCGACGGCCACGCCATGCGAGCAGGCCCATATCCG
CTCGACGTCGCCGCCAACGCCTTCTCAGCCTTCCGCAGGATTCGAGCCAGAGTAGTCGGTGGCACTCCGAGCAGCATGCTAAGCGTGCTGTTCTCCATTT
ACCCGACGTAAAACACATGACGAGACCTAGGACTTGGTACAGATATCGAAGCTTGGGTGGGCAGCCCTTAGATGAAGGGACGGAATGCTGTAGAATTGTG
CAAACCGGTGAAGCATCGTGCGAAGGACGCTCTGCACCAGTACCAATAGACAGTTAATACCTCGTTTTGGACTCATAAAGCTTAGAATAGGTTCTTACCT
CGTTAAACTCGTTGCATTCAAGAAGTTTTGTCGTTCCCGGGCTGTACAGGGACATCCAGGCTGACTCGGTGGACTTCTCGAGACTACTCGCGGTAAGCTT
CGATCGCATAGCCATCCGCCACACCTCCTTGATCATGAGCAGGAAGACTTCGTCTCGAGCGTCATCCACTTCCCTCTCGTACTTCGCGAGTGCCTCGCCC
ATGCACAGCAGCAGAGACGTTGTAGTGTCTTTGCCGTCCTCCATCTTGCGCCAAAGGTACTCAAAACACCGAATGAGCCACAAAGATAGAAAATGGAAGG
GTCAACACCACGTTTTGTCCAGATAGAAGTGACTGGTACATTATATTTGCGCTATTAACAAGACAAGCTGGGACTGTTTTCACCGGACAGACGCTGAGTT
CTTAATGCATTTGTGGTAGACGCCAGCCACAAAAATTTAGAATTTATCTTATTTAAACCTGTCTTATCCGCTGCGGATATGGTGGGTAATACTGCATTTT
TGGCAGACGTCCTGTGATAAAGCTAATAGCACTTTAGAGAATATGATCAAGTTACTTCTTCATTATGGTATTAGTAGCGGTTACTGTATCTGTTATTGTA
TCTGGAACTATCTGTCATTATGGCTCGAATAAACTTAAGTCTACTAGCAACCGTGTTCTTATTGCAGACCTGCTAGTAGTGCATGCTTATTCGTCAAGCA
TATGACATCAAAAGTGTCTCACTTAAAAAACGTTTTATGGCATAATTAAAAACAAAAGTTAATTATAGCTCTCCGTTTAGCTCGTAGCTTACATAAACAC
TACAAAAGAAAATTATGATTGCAATCGATGCCACCTTCGCTTCGCTTGGCAGCTCAGAGTGGATACCTTGCGAGATCGTGCTATGTTTTCCGTTTGTGCT
ACGTTCACCACACACAGTTAACACTGTATGCCACATAAACCAATGATTGCCAATCGGGGCCGCCGTCGCTCTGCTCGACAGCCAACGATATTTCGCTCTA
ATTTCATGACGGACGGACTGACACCGTGCTAGCGTTGCTGTTTAAGACTAGACGGGCGCATCGTTTGAGGCGGTGGTAGCAGGTTTTAATCCCAGCTTTT
TGAGCCGTCCACCTCAGCTTCGCTCCGGAGGACTACAGATTCTCTTACAAAATCAAGATGTAGTGGAATCAATACAGTTCTGGTGAGAAGATCTTTTAAA
CATGGAAACACATGTATTAATATGTATGTGAAGCTAGCGTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGAAGAAACGTAATAGTTTG
TGGTCTTGTGTATGGAGTAGTAGATCCTGAGGCTGAGCCAAATTGCCATCCTCAATACGAGTCGCTGCAACCTCAGACACTGTAGGACGGTTATGCGTTC
GAGGCCCAACAGAATTGTCGTGAAGGCGAAACACCAAATCAACAACGTCATCCGTGTTGTGTTGGCACACTTGCTCCCCGAAGGAGAGAAACTCCTTGGC
TAGTGGGTTGTGCTCTGCTATCATTTTCTCAATGTCTAGCAACACAACGCGATTGAGGTCTGCAATAATCCCCATACGCCGCTCCGCGCGGCGCTGCATG
TGGAGATCCACAATATAGATCCGTGTAAACTTTGGGATTCTCTCTCGCCTGTCCGAGGGTCGATTAGTGGCAGTAGGGACCCTAAGCAGTGCTCCATGGC
TCCTTGAATGCAATAAGTGTAAATACCTCGCCTGGCACGCTTTCGGCTCAGCATACGCTATCAAATGATTGATTCGAACAGGACGCTTCACTTGGCGAAA
AAGCGGACGCTTGGTAGTACGCGCGGACACCTCGACGGAACTGAGGGTCTCAATGTAGCTGGAGCAATTTAGGTTGATCTGGTCGTAGGGGACAGGCCAC
TTCCACGCGTTACCGTGCGGAGTTGTAGGCGGCAGTTTGGGTCACCCGTGACCGTCGACGCCTCAAAAACTTCATCGGAAATAAGGGCGTGGCGTGACGG
GTACATTGGCGTCCTCTTCGCAGTCTCTCGAGTTCAGCTCAATGTTCTTCTACCGTCCGTTGCCCGCGTCGTTCTGCATGTCGGTCACGGTCTTGCTCAC
GCTCAGCTTCTCGTTCTTACTCCGAAAGCGCCGCTCTTCGAAACGCATGTTGCTGTCTGTTAGTCACCCGAAGGACAGAGCAATTGCTCTCGTTCAGCAG
CACTCGATGGGAAACGCGATACGTTGTATTTACCTCGCACTCGCGGTCTTCCTGGCTCAAAACCGCACGTCTTTCTTGAAAGCAAACACTCTCTTGCTCT
CGTCGGTCCTGGAGCGCGTCCCCGCTCAGTCGGGCTCTTCGCGCACGTTTGCTTAGCATCGTTCTTGCTGGCACGGTCGCGCTGAGAGAGTGTCATATTA
GCTTGTCTCGTGCATCACTGACACGTCGACGTTCTTTCTGAGGTAATGTCATGTTAGCTCGGCTTTTGTGTACGCTGCGCATCCGAAACGGGGGCCACTT
CTTGAACTGAAGCTTGTATTACAACCGGCACCTAAAATAAACCTGCAACCCCCGGCTTCCGCTTGATATGCCACTTCCATTTCAGCCGCGAACAGTCGCA
GATGTTCTGAAGGATCCGACTCTTCTGTCGTCTCCTCCCGTTCTTGAGTAGGTGCAGTACGACTGTCCGTAGCGGGGGGTGGGGCACGACGTGCTGCACA
CTAAGAGCCTTCAGCGCTTTGTTCAAGTCATAACGTCTACAAATGCAAACTAACATGCATACACGCAGCGTATCTCACGTGGGGTGGCGCTCCGCGGCTT
CCAGTTTTAAAAATGGGGGCAAAAAGAAATTTGAACTTGCAATTAAGTACGATATGTAGACCACATACAACATGACAATCACACAATTATATATCAGCCA
ATTGGGGCCGCCTTCACTGCGCTCAGCAGCTAGTAAAACTGCGGGTATATGCGTCACCCCTTTCTAACTCTAGCCACGAACGGAAAGACAGACACGTTGC
TCTAGTTGAAAGTAGTAGAATGAATACCTAGTCTCAACACGATACAGATACATCCCCACTCTCTATTTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACACAGATTTAAGCGTAGACCGTTAATATGTGGAGTCACGTGCATGT
TTTCTGAAGGGCTATTAACACGAGGAGGGATTTTGGTGGAAATTGAAACACGTTTCGTGAATATATTAAATTATAAAAAACTAGAGTGGGCCTGCCACAG
TAATGCTGACGTAGTTCACTTGATAAATGGATGCAAAAGAAGGCGTGAAAGCGGTCACACCATTCGCGAAATCGCTTATCCTATCAAGCGCTCCAAGGAC
ACAGTGAGCCGTGTTATCCGCGAGGGTATCCGAGCCACTAAGGGCAAGGGACCGAAGAAGACCAAGCCGCGAGGAAGACCTCCCCGTGCTATCGCTCCGT
GAAGTTCGTCGTGTCATCCGGCTCGCTGGGACCGGATCCTACACATCTGCGCAGCTCAAGTCCCGCACCGAGACTAAGGCATCAGCTCGCAGCCTTCGCC
GGCTTCTTTCCCGTGTAGACTATCTAGTATACACAAAAATGGAGAGCACGTTAGACTTGTCACCTGCTCACAAAGCTGTCCGACTGGACTGGGCAAAAGT
CATGATTACGCGCGACTGGACTGACGTCGTCTTCAGCGACAAGAAAAAATTTAATCTCGACGGGCCGGATGGCTACAAGTCGTACTGGCGTGACTTGCGT
CACCCGGTCCGAAAATATGTCAAGCGTCAGCAGGGGGGGGGTTAGTGATGGTATGGCAGCATTTAGTATCGAGGGGAAGAGTGAGATTGCGGTGCTGATG
GGTAAGCAGAATTCTGCTAAATACGTCTACACGTTATCTGAATTCCTGTTACCGATTGCCCACCTGCACCATGACATTGACTTTGTTTTTCAGCAAGACA
ACGCGAGTATTCACACTTCTCGCGAAACTCGCACTTTCTTTGAAGAAGCGCAAATAGAAGTGATGAATTGGCCTGCGAGGTCTCCGGATCTTAATCCTAT
TGAGAATCTCTGGGCTATTTTATCACAGGAGGTCTATCAAGACAGTTGTCAGTTCAGCACGACACAAGAGCTCACCATGGCCATCGTTGCAGCCTGGGCC
AAAATTCCGCATAAAACATTGAAGTCCCTGATCTCCTCAATGCCTCGCCGCTACATTGAAGATATCGAGCGTCGAGGAAACAAGACAAGCTACTAGGCTA
GCTATGTTCTAGTCATACTGACAATCATTATGATATGAAATAAAGTATGCCCTTTTGTCCGAACAATTTTGACCCTCTACGAAAAAATTAACCTGTATGG
GAGGCCATCGAAGGCCTTCGAATTCGCAAATATTTACACATGCCTGCTATTTGCTATTCTGATCGACTATTCACATCTAAATAGCAAGCGCTAATTTGAT
CTACAGCCAAAGTTATCGTAATTTTCTGGTGTCCGAAAATTTATGGCCAGGACTTTAGTTCGAGCACTGAAGTACTCAAGTATAGGGTAAACAAATGCAA
CCATAATAAAATAGGATTCTAAAGTTGATTTTCGCCTTAGGAGCTTTCTGCAGATGCAGATGCATTTCCTTCTCTTCAACTCTTGCAAATGAAGCTATAA
AACAAACCATCATAGATTAAGTTTTTTTAATATCGTAGCGCTTTGTGGAGGCTAAC