Description :
From Genome Similarity Track
Location :
Scaffold_396:7942- 9536
Sequence
1594 bases(100 bases per row)
TCAGTCCACCAGCGTGATCCGGCCCTCGAGCTCCGGGTACGAAAGCAGCCGCTTCTTCATCATGAAATCAGCAACGACTGTCGAGATCTTGTCGAACGTG
CGAACGACCTCGCCTTTGAGCCACGACGTACACCCGTCCCCGCCGTTCGCGATGAACTTGGTCGTCGCCACGAGCACCGTCGAGTCCAAGTCGATATCCT
GTCCAGTCTCGTCTGTCATTGCGGTGATCACCACAGGCTGGCTCGCAGCCTCGACAGTCAGTCGAACACCGGACAAATGTGGGAAGGAGCCGGACGGTTG
CGGATACTTGGACATGTGCTGAATGATAGCATCACGGAAATCACGAGCCTTGATGCGGATCAGCACAGCCGGTCGTGGGAACGGCATCTCTTGCTTCAGA
ATACCCACAGTCACACTCGTGCGGGCCTCATACATCTTGTTGCCGCGGATAAAACCACCGTTGATAAGTCCAAAATCGGCGTTCAACTCGGTGCGCAGTG
CATCAGACACCAAGTTACCCATATTGCACTCTCCAGCTCGCAATGCCGCCGTTCGAGTCGACAAAGGCGTCGCAAGCAATGCCAAAACGCGACCATTGTC
GCCGGCGTTCTCCTCGTTCTCCAGCAACTGCATGTACTTGTACACGATCTTCTGACACTCGGGTTGTGGCGGAATGTGCTGATTCGCGACCATGCTCCAC
TGCGTCGACACGGCAAGCGGTCGCTCTGGGTGCTTGGCCGACTTGGACAGGTGGAACTCGAGCTTGCCGAGCCAAAACGCATTCTGACCCGACTTGTGGA
TGAACGTGTTTCCCTCGTACAGCGTGAATGGTTCGTGGTCGTGGCCACCGAGCATCACATCGATACCCTTGACTCGGCGCGCGAGCAGTCGGTCTTGTTC
GATGGTCAGGTGTGTGAGCGCTACGATGAAGTCGGCGCCTCTAGCCTGTAGTTCGTCCACACATCTTCGCGATGTCGCGAACACGTCAGCGAACTCAATG
TCCTTGCCGGGATTCGATATTTGCGGAGTTGCCTCTGTGCACACTCCGAAGATTCCGAGTTTGAGTCCACCATTCAGCTCGACCATGTCAGTGTCGATCA
CGCTCTTGAGATTACCACCAGACTCGCGCTCGAGGACGTTGGAGCCCAAGTACTTGAACGTGGACTCTGCTATTCGATCGCGGAGTACATCCGGTCCAAA
GTCGAACTCGTGGTTTCCCAGCACGACGTAGTCGATCGCCAAATGGTTCAACAGCTCCACCATGTGTGATCTGTACAAGGCACCAGCAGTCAGCAATTAC
GAACGTGTCCGGGTGGCAAGCGAGATCGACAAATGGGGACTTACCCCTTGGTACGCGCGCCGATCGCGGAGCCAGATAGAAAATCGCCGTTGAGAGTCAC
GAGCAGCGTCGCATCAGGTGGAACAGCTGCACGCTCATGTTCCAGCAACGTCGCGAACTCAGCGAGACCTGCCGAGCATCAAATGGCTTCAGTCAACAAT
GTTGCAAGTGTGGATAACCATGTAAGGAGCTATTGGTGTGACCTCCTCTGCCGTGTTGATCCGGTTGTAGGTCGTACACGTCGTTGACGGTGAG