Description :
From Genome Similarity Track
Location :
Scaffold_1077:7941- 9108
Transcript NameFunction/comments
g16025.t1hypothetical protein

Sequence
1167 bases(100 bases per row)
TGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACC
AGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGGGTCGGTAGTGATTGAAGCGGAGCCTGC
GAGTTGGGCGCAGGCTTCACGCGCTGGCATACCTCGCAAGCACGAACGTACTCGCGTACCCATTTGTACTGGTGACTCCAATAGAAGTCACGCGTGAGAA
GCAAGTATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCATGATCATCCGGCACGACAAT
GCGATCTGCGTTGTCGTCGACTGCTCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTGGCCAGCTTCTGACGA
GACTTGTCAGAAGGTGTGGAGTAGTACTCCAACAATTGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACTTCGTCCAGCAGGGACGACGAGGGTG
TAGTCGTCCTGACGACGCCAACTGCGTTGGCGTCGGCCTCGTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACCTTCCAGG
TTTGTACTCAACCTGGAAGTTGTATTCCGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCG
TGGTCGGTGTAAACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGT
AATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAACCCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATC
GGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTACTTCGAAGGCCTGCTGA
CAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCG