Description :
From Genome Similarity Track
Location :
Scaffold_44:7940- 9557
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_44-fgenesh-gene-0.1ADP-ribosylation factor family
Pytar_ATCC12531maker-par_contig_44-snap-gene-0.23GJ14593

Sequence
1617 bases(100 bases per row)
GCAAGCAATGCGATCACGGGCAGAGGCGTGGAAGAGGGCATCGCGTGGCTCGCCGAGCAGTTTGCCAAGGCCAAGTCGCGGAAGTAGACTGAGTGCTAGG
TCGGTTTCGGCCATTCCTCTTATAAAATCACAATACCAAAAAGATACAAAGCTGATGTAGTCTCGCAGCATGTGAGAAATCCCTTTTGTGCGATGAGAAA
GATATATATTCAATGCTGTTGACTCTGTCTCTGTGTGGCTCTCCGATGATTTACATCGTCGCTTCAGCCGGCACGACGGCTTGCTGCTTGGGGTCGCTGG
TCGTGTTGTTGGCCTTGGGCACGGGCAAGAAGAGCTTGAACTCGGGCGGCAGTTCCTCTTCCGAGTAGAGGCGGTCGGAAAAGTAAATGCGGCGGATGCG
GCAGTTGGCGTGGATCTGGACTCGTAGTGTCTCAATGTAATTCGTGCCGTACGCGCGGCGCGTAAAGTCGGAGAGATTGAACTGGATCTGGTTCCAGCCT
TCATCTAACCGCATGGGCATCGTGCAGATGAACGGCTTGACGCGGGTCGAGCTCTGGTAGTTGGACGCGCGGAAGCGGCGCCGCACGTTCTTGTCGTCGA
GCACTTGCACCTCGAACGTAAAGTACTTTTTCAAGTTCTTGACAATCATGACGAGAAACGGTAGCTTGATGCCGAGCGTCTTGGCTGGTTGCGCCGGGCA
CGTGATGAAGTTCGTGCTCACGTTGGTGCCCATGATCTCGAGCACGGACGACTGGATGTCCTGGTCCGTGATGCGCTTGATGTGGCCATTGCGGACTTGC
TTGTCCCAGATCTGCAACGGCTTGCTCCTGTACACACGTCGAGGATGTTCCAATGGACCATTCATCACAGACGGAGCCATAGAAAACGAAGAGCTACGCA
CCCGATACTATAGAGAATGGACAGGAAGCCCGACTGGAAAGTGTTCTTAAACATCGCCCACTTGCTCGTGGAGGCCCAGCGACAAACGGGGGACTGACGC
AAGGAATGCCAACCGAGTACGCGACGCTCTGTGGGCGGCGTGAAGCGAGCGCGACTCTTTGACCCGCGCAATCTATGTCTGGTGCCGTGTCCGTTTTCGG
CTTGGTGGCGCCGCTTCAAGGAGATTATCGATTTTGGAAGAAAACGAAATATCGATCTTGACAGGTGGCACTAAAAAGCGCTTTTTAAGAACCACTTGTG
TACCCAAAAAAGGTGTTTTGGGGAGGTAGCCGGAGAAAAAAAAAATCGAGCTTTGGTCCAGTGAACCAAATTTTAGCATGATCGTGTAGCGGTGTGTCTT
GCGATTCGAACGCACCAAGTTGTAGTCGCATCACATGAGTCTGGGTGAAGATGCATTCTTCCCCGCGTGCCTCCTTGGTGTTGTGCGTCATTGCCTTCAA
AACGTGTTTTCATCGAGGAGTGCTCCTGTTGGTACCACTGTGACGATACCTACAGGGTGATATTGACTCCACGAGGTTCCATGAAGTTCAATATGGTTGA
ATATTGTAGAATATAAAAATGGACTTCACGCTGGCTACTGTTCCCAAACTCACACGCCAAGGCCTCGCTCGTCAAGAAATGCACAAGCCTGTGCAGTGGC
GTCGCGCCTGCTGGTGC