Description :
From Genome Similarity Track
Location :
scaffold_1368:794- 4347
Transcript NameFunction/comments
g11335.t1hypothetical protein

Sequence
3553 bases(100 bases per row)
AAGTGCGAAATCGGAGCTTGGGGACGCAGATGAAAGGTGGATCAGGGCTCACACGGCCTTCACGGCCTTGAAGATGAAGATCGCGATGACGTCGATCCTG
CGCCATTTCGATACGACGAGATCACCTGTTGTGATCGTGTATGCTAGCGACTGGGCGATTTCTGCCGCGCTGATGCAAGAACACGACGAGATATACCACC
CGGTCGCATTCGCTAGTCGTACATTGAAGGTGAACGAGTTGAATTACAATGTGGCGGAGAAAGAAGTGCTAGCGTTGCTGCGGATCCTAGATCTCTACTA
CAATCTACTAGTAGGACGCGAGATCAAGGTCCTGACCAGGCATTCCACGTTCGCCTGGCTATTCAAGTCGGCTGGACTCCAGGGTCGCCTAGGACAGTGG
TCAGCACTCCTGTCACCGTGGACACTCGAGATCACGAAGTGTACGAAGGGTGAAGATGAGATACTGGGGGTGATCGCAGCCAGTATCACGCCGAGATCCA
AGATCGACGAGGCATTAACCGCGATCGCGCCTCGGAAGGAGCCTAAACGCCGGGTCCAGGCACCGATCCCCACTGTGGATCGAGATGAGGAACTATGGGT
TGTGAGTTCCGATGGATCAGCCCGTGTGAAGCGAGGTGGGGGCGCCTCGTGTGGAGTCTGCCCGGGTGGAAGGTGATCAAGGCTAGATCAGGCTATACCG
AAAGTCTTACCGTCAATGAAGCCGAGTATAACGGCCTATTGCTTGGCCTTGGACTGCTGAAGGACCTTCCGACGTTTGGTGATCTGTGGTGACTCTAACC
CCGTGATCAGGCAAGTTCGCGGCGAGATCGACTGCAATGCGCCGGGATTGACGTTGTTGAAGCAGAAGGTCCTCGATCACCTGAGAAAGTGGGGTGATCA
CGAACTGGTGCATGTGAAGAGAGACTGGAACGGAAGCGCGGACAGCTTGGCGAGTGCGGCCTTGCAACGACAAGACGGGGTCGAGGTCCACAACGACGCG
GATCACCAGGATCTAGTCACCCTTAATCGGCTAAACGAGATCTTGGCACCTAGGATCGAAGATCCAGTGGTACGAATCTCGACGGTGGCTACACGGACCA
GTGTTCGAGCGAGATCCAACGCCGCCGTCTTGCAAGAAGAGTTGATCCGAGAGATGCGGATCGATCGGATTAAGCGAGCGCAGGATGAAGAGGTCTAGAT
CGCGGGAATGAAGAAGTACCTGATCGGGCAGATCGCAGATCTTACCCAGGCTGAATCTCGATCCTATGGCAAGATCGCGGCAGATTACGAGGTGGACGAG
CATGATCTGCTCTTCTATTGTCCTCCTACGACGATATCGAGCGATGATCGCGATGGATTGATGGGGCTGGTTGTTCCGGAAACTCTCCAGCAAGATATTC
TACCTTGGAAGGAGGCCATCAAGGAATCGGCCGTACCTACCAGCGGATCCGAGATCACTTCCACTGGAGAGGTTTGTATCGGAGTGTGCAGAGATATGTG
GGTGAATGCGCGGATTGCGAGGCCGGCAAAGGATGACCCACGATCCAGGGTCACCCGGAAACCTACTAGCCACGTACCCATTCCAGATCATAGCGATGGA
TCACATCCTGTCCCTGCCCAGATCCAACAAAGGCAACACGGAGTTGCTGATTTGGGTCGATCCGTTCCCGGGGTACGTGATCGCGAAGGCTACCTCGTCT
CGATCAGCCCAGACCGTCGCAGAATCTTACGAGGAGTGCGTGTTCCGACGATTCGGGGCGAGCGTGACGATCCAGCATGATCGAGAGCCAGGATTCATGT
CAGACTTCTTCAGCTCGTTCAACAAGATTCTGGGACAGCGCCAACGCGCTACGATGGCGTATCGACCTCAAGCTAATGGGACCGCAGAGAGAATGGTGCA
GACAGCGACGAGAGCGCTCAAGATGTATGTCCAGGATCTGGATCAGAAGGACTGGGACGAATATGCAGAGCGATTGACGTTCGCGATCAACACGGCTCAC
GACCGAGTCCGAGGAGATACTCCTCACTACCTGGCACATGGATGGGATCCAAGATCTACGCTGGAGGCGACGATCCCAGTTGGATCTACCAGACAACAGG
ATTGCGATCCACGCCGGTGGCGCTATCGGATCCAGCGATACTATCAGCAGTCACGAGAACGAGTCAATGCTAGATTACGAGATGCGATCTCGGATCGAGC
TGATCGACACAACGAGAATGTTGATCCACACCAGATCGAGGTTGGATCTCAAGTCTGGCTGTATCTCGATCGAGTGAGAGAAGGTTACGCCCGTAAATTA
GCCCACTTCTGGCATGGTCCATTCCGAGTCGCTGAGAAGATCAACGAATTCACGATCAAGCTCGAGATCGCGGGAACTGGATATCATATATTCCCAGTGG
TCCATGTCTCGAATCTGAAGCTGGTGCGGAACTTCCCTGATCGACCCCGGATCGAGCTGACGGTAGTTGAGTCGGATCGTCTCGACTTTGACGAGATCCT
GCTTCCTGAGGACAGCTGGGTCCCGGATCTGGAAGCCGATGAGTACGAAGTTGAACGGATCTCGGACAAGCGAAGTGGGAAGAGAACTCGCTATGGCCGG
ATCTATCGAGAATTCTTGGTACACTGAGTTGGTTATGAAGAGCTGACCTGGATCGATGAGGCGGACCTCAACTGTGGTGCCATACTGAGTGCGTTCCAGC
GAGATCACGTGAATCGCAACCGGTTCGGCGTGATGCAGTCGCATGAAGAAGTGTAGAAGGGCGATCGGTAAGTCGAGGTGGTCGTCTCGCCGAGATCTGG
AGAGCGATCCGGATCAGGAAGAGGACGTTGAATTTTTGTATATGCATGTGAAAACAGGAGTGATCGAGGTCGGTGAAAGGTAGTCACGAATGGTTAAGTG
GAGCGGGAGCGGGATCAAGTGCTTGTGAGGCCGGATCACGGTATACATGACGAATTCAAGTAACTGTCGGGCAAAGGAGAGGCGATATATTGTGAAACGT
TAAGAGAAACGTGAAGAAGCCCCAAGTTGGAGCCTGCGACTGCAGATCTGGAGCCCGACGACCGTATTGAGGGTTGCTGGTCTTGGGTACTGTGCACCAG
TTGTACCCATTAACCGGTTAACCCGAACCGGTCCAATACGATCCCGCGATTATTACGGTACGTTGTTTACGGCACCGATGATTAGACGAGTAGGATGATT
GGACGAGTACAGAGTGTTGGTGATTGGATGCGCCAAATGATTGGATGCAGACTAGGTAGTGAAGACAGTGTAAGCTCCGATCAATCAATCACTTTCGAAT
CTTCCTTCTTCCCCTCAAGTGGTCAAGTGTCCTCGCTCCGGTCAAGTCCTGAGTAGCGACTCTCCCTTCTCTTCGTTCAAGATCCATACCTTCCATCAGG
TTATGAGCCCAAGCACCATGTCCTCTGCGCAAGACGCCTCGACCAAGGTCTCCATTGACAAGTTCAACGGGGACAACTACGCGACGTGGAACCGCTACAT
GCGTGGCGTGTTCCTGACCAAGTCGACGTGGCATGTCGTGAACCGCGAGACGA