Description :
From Genome Similarity Track
Location :
Scaffold_337:794- 3911
Sequence
3117 bases(100 bases per row)
GCCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTACT
GCGGCAAGGGCGTGTCAATGACCAGCCGCTACTACCATGCGGCTCAGCGCCCCGACGAGACCCCTCTGGATTACTTGTACCGGCTCAACGTCGCGGGCTT
GAGGGCCAACATCCCATACGCCGAGGGCACGACTGAAGAGAAGCGCGAACACGTCGAGCATTTCATCCGGACGCTGAACACGCAGGAGGCCGAACTCGCC
TCGCGTCTCACGCTGATGGAGGTCGCCGACTCCGAGGCGCTGGAGAAGAAGCTGCGTGCCCGACAACGTGGATTGGCTCACCAGAAAAAGACTCTCTTCG
GCTCGAACAAGTTCCGCCAAAAGGCGCCGACCCCGCCGACTCAGCCGGCGCGCGCCGTGCATGCGATTCACGTTGCGTCGGACGAGTACGACTCGGAACG
CGAGAGTCGCGACAGCGACGATCGCCAGTACGATCAAGACGGGGAGGACGAAGAACGCGCCAATTTGTTCGTCGCGGGGCAGACCCCGCCGGGAGAGCCG
GCGCGTCGCAACTTCGATCCCGACGACTCGGGACGCGACCGCCCGCGGTGCCGCCACTGTGGTTCACGTCGCCATGCCGAAGGAGACTGCTGGAAGTTGT
TGACGTGTCAGAAGTGTGGTGGCCAGCACCCGACGGAGTGATGCTTGAGGGTGTGCAAGGCCTGCGGTGACGTGCACGAAGCCGGAGAATGCTCGATGGA
GGAGTTCTTAAACCAATTGCGCCAGTGGTTTCACCCGAATAAACACGCGGGAATGCTGCCGCCGGCCGCCGAGAAGATGTTAAACTAGGACGCTCGCTGG
CTTGGAAACCAGTACGAGACGAGCGACCTGTTTCCGTCTATGCATATGTGACCAAGAAGTCGCGAGAAGTGGTTAGTGAGAGCCCGACTTCCCTGAATGA
TAATACATGTGAATCCAACCTGGAACGTACCACGCAAGAACGCGCGCCGCGAATGTCGGCGGTCCGACGTACGACGGACGACGAGTTTGCACGTGAACCA
CCCCTGGACGAGATCGACTTGCAACCAGACGAGCGACGCGGATACTGGAAACATTACGCGCCGCACAAGTGGTACAAGCAGGCCAAGATTCATGGAAAGC
TGAACAACCGCCGTGCTGTGTTATTGCTCGACACAGGTGCCGAGGTGTCCATCCTGGACACCACCTTTGCTCGTGAGGTAGGCTGCCTGATTGACACGGA
GATCACGCAAGAGTGGG