Description :
From Genome Similarity Track
Location :
Scaffold_3064:794- 3014
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3064-fgenesh-gene-0.0Alpha mannosyltransferase

Sequence
2220 bases(100 bases per row)
AACAAGGCCGCCACCGAATCTGCTAAATGCGAGCTCGGAATATCTGGATGCCACGAGAAGAGCTCATGGAACAGCGTCACGTTCCCAATCACAGGCTCGC
TCAGCATAGCCTCGTACTGCTCAACTGACTGGTGCACCTCCATCACGCGCTCCGCACACTTTTTCAGCGTCGCAAATCTCCCACAGTCGATGAAGCTCCT
GGGGTTGAACAGCTGAGATACCGAGTCCGAGTGACCCAAGTAGATCGGAATGCTCCCCGCGAGAAACGCGTTCACGATCTTCTCCGTCACGTACCCAGGC
TGTTGCTGGGAATTCTCGAACGCGATCACGAACTTGTAATCGGTGTAGATACTGACCGCTTTCTCGTTGTAGAGTGGGCTGAGGCGTCCCGAGAGACGGT
CACGCAGCATCCCACGCGCTGAGCCCTGGCACATTCCCAGCGCGTCGACCGACTCCATGGCGTTGAGCAAGTCAAACATGTACTCGCGCTGCGGCTGGTC
ACAGCGTGCGTACATGTAGGCGCAAAACTTGCGAGGGAATGTCGACGGCGATGGCTGATTTGGCTTTGAGAGCAGCAGCATCGGACTCTGGATCACGCGC
TCGCTGAAGGACATGCTTGCCATGGACAGGTACACATGCTTCTTCCTGGCGACATGGGCCACACTCGAGAGCAAAACCACCCGCTCGTCCAGTGCGCTGA
CAGCCCAGGACTCACTAGCGACCATTATCAGCGACGACTTGTCTCCATACTGCTGGACGTACTTGGCTGCTGCTTGCTGACAGTCTGGATCCCACGCAGA
GCCACAGAGTCCGCCATCCAACGCCGAGAACAAAAACACGTCTGGGCTCAAAGCGCGTCTCTGAGCTTGTTGTTGCTCTTGGAACGTGAGCTCGTCGACC
ACTCGAATTGGGTTGTGCTTGTATATCGAGATGAGAAGACATTCGATCATGGACTTGACCGGCTTTGCTTCGCGTGAGTACACCACTGTGATCGGTGGCA
CTTGTGGCTGCGCTCCGACAAACCGGAGGTTGTGAATCCAGAGCGCGAGGTGCGCTGAGTCAATTGTTCGATCAGGGTTGCCACTGCTCACGACTTCCAG
CATGTGTTGTCGCAGCCCATTGGCGAAAGCTGCACACGCAAAGCCCGCTGGGAAAACGTGCTGCTTGATCCGTAGACAGAGGTTCGGAAGGAGATCGTCG
AGCAGGTCGGTCGCTGGTAAATAGCTGAACGCCCACCAGTCAGAGCCTGCGGAGGTCGACGTGACGTTCACAAAGACCTGCGTATGTCTGTTATCGCCAC
TGCGCTGGACGAAAGTTGAGAATCGCACGCCTGTCTTGAATGCAGAGCTGCCGTCGGACGACGCCTTGCGCCACGTATTGCGATCAAAATCGGCGCAGAA
CGGTCTCTTCGCCTTGAGATTCGCGTGTGCGATGCGCATCGCACTCGGGGACAGGTCTGCATACGAGACGAGACTTTCTCGACACGAGCCCGAGTCCACG
TTGCTAAACTCGACGACATTGCGCGGATGCACTTGCATCGTGAGCAGCCAGAGCGCGATCGATGCGTCGTCTAGCCCTCCAAGTCCTTTGAGGCGGTGGC
GATTCCTCCCGATGAAGCGCGCGCAGTCAGCTGAGACCACGAAGTTGCATCCGTGAGTGAACGGCGGCAACTCTGGCAGAGGGTACTGGTCCACTGACAG
GTAGTTTTTGTGGCCTGGGTCGCGCTCTGGCGGGACCAGGTTCCCATCTTCACCGTACATGATGTGGCCAGCATAGAGACGTTCTGGTGGCCACCTATGT
GAAAGGATCAAGTCGATCAGGTCGTGTGTGCGCACGTAGGCGTCGTCGTCGGTGATCATGATGTACGGTGCCGACGGGAACTTGGTTGTTGCGAAGTGCA
TAAACTCCTTGACTTTGTCCGTCAAGAGGTAGTACGAGTCGTCGCAGTCGAGTTCGTTTGTGAGCAGATCCTGGAATATGCGCTTCTCAGTCTCAATTGC
GAGCTTGAGCTCTTCGTTTGGAGGCGAGACGACACCGTATTTTGAGCCAAGCATGGATCGGCAGCCGAGGAAGAAGACCTGAACGGATCGGTGACGAGAT
GCATTAGCTGCCCATGAGTCACGAATCGACTGGCGCTGGGCAAATCCGTGAATGACGCTCGACTTGACCCCGATCACGACCAGAGGCGGATCTTGGTTCA
TGTCTTCGTGCGGTTCTTCT