Description :
From Genome Similarity Track
Location :
Scaffold_2481:794- 2679
Sequence
1885 bases(100 bases per row)
AGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGTCGATGAATACATACCGTACCCG
CGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGT
CCAGGATGTGGGACAGCAGCTGATCTTCATGGAGTTCCCGTAACTCCGTGAGTACTTGAGGGCCTCCACCCAGGCCCAGAACATATCCTCACAAGAACGC
CAGGTGGGACAGTTCTCGGGCAGAACCCAGGGGTATCCCCACAGAGGTTAAAGACCACCCCGGTTCTCGGGCTTCTTACGACAAGTCGTAAGGGGGGTGC
GGTGAGGTGCGAGAGGCACACACCGAGCAGCCTCCAAGCTGTCAACGAACAACTGCTCCTTCTGAACAAGGGCGCGCTCGTAAATGCCCCTAGAAGTAGG
TCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTTCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCT
CCCTGGCTGACGGGTGCCGCCACCGAACCCCCACACACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGCTC
AACGATAGCACCCTCCTTTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGTCGAAGATACTCCGATAGGAGCGACGAGTCTCCTTCTCCTCG
CGGAATGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTT
TGCGAGGACTCCCTTCCTCATCGCCACCGGCTTTGGGAGTGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACC
GTGATCACTAGCGGACGACTGCACGCTGTCTTCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCATGAGTGCTCTCG
GACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCACGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGACGAGGGCGACGGACTGCGGCGCCTGC
TTGCGCGCTTGTCCGCAGCCGCGTCACCCGAGGATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTAAGTGCAGAGCCTTTGCCGTGAGGCTTAGT
GCTCTTGGCCTGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCACGAGGCATGTAAGAGCGCACAGGTTGCTGCTCG
AGGCTCTAACTGTAAAGTGAGCCTCCGCCGCGCTCGCGCGGCCGAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAAACATCTCTTCATTC
TGATTGGTCGGTAAACCCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCACTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCA
GGAGTATGACATGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCATTCAAAACCAACCATTGGTTAAATGACATTGCATTTCTATAGGTAACTG
ATAGTTTGTATTAACCTCAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGAC
CTGTGAGCTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACA