Description :
From Genome Similarity Track
Location :
Scaffold_523:7937- 12932
Transcript NameFunction/comments
g17625.t1hypothetical protein

Sequence
4995 bases(100 bases per row)
GACGGAGTGTACACGGCGAACATAGTGTACCGACAGCTGTTCGAGAGGGCGTAGGCAGCGACTTCGTGTGAATGCATATTTTACGAAAGTAATACATTTG
TCACTTTGCATAGCGGTAATTGTTGAGAGTCACCATTCCCCCTCGAGCGCAGCGAGCACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAA
ACCCAGGACCAAACAGTGCATGGTAGACAAGCGGAGGCGAAGCTTGCGAGCCGCAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGC
AGCGAGTACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGTGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAG
CCGCAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAA
ACCCAGGACCAAACAGTGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTGTGGTACAAGTCAACATTAAAACGTATCGAT
ATAAAATATAAGCCTTTCATAGTAAACAATAGTAGTGAAGCGAGCTGGATGAGCGAGCGAACGGGCACCAACCAACCATGCACCCACCGCCCGCAACGCG
GGCGGCGCTCGGCTAGTCCCCTACAAGTAACAGAGTAACCTGTCCGTCCGTCCGTCCGTCCGTCTGTCCGTCATTCCGTACGCACCCGGAGCGTAACGCA
AATCCGGACTTTCCGTTGGCTATAAATAGCTGCCGAGCGCAGCGAAGGCGGCCTCCCCATTCGCTATTATTATAATACGAGGCCTCTCATTGGCTATTTA
GTGGAGCCTCTGCGCGATTGGCTATTATAATGCGTAGAGTGGACTACATCACATCGGAAGTAGCCGAATGAAATCACTGCTGATTGGACAAAATAAACCG
CCTTTCAACAACGTTTCTTTTCATTTCCATTTTCAAAACGACGCTCCGGCGACGGACCAGCTCGACGGAGGACCGGGCGGGATAGCTTCGCAGGCAGGTC
ATCCCCGCCGCAGGCAGGGTAGGTATAGATTAATCCTATTTAATTCTAATACATAACGATTTCGGGAGTGCCGCCTGTTGCGGATAACTGGTACCTTCAG
GGCAGTCGAGGGGTAACCGTGCGTGTTAGAGGAGGATAACCGGAGCCGTGCATTGTGTGGGAAGGGCACAACTGCATGGAGGGATGGGTACCCTATGACG
GCCACACTGATGCGGCCTAGCCAGCCCCCAAGAGGATCCCATCCCTGCCCAGCGAGCCAGGCCGACCTCTCTCGAAGCAATCGTGACGGTTACCCCGTAT
TTTCGGGCTTTCTGGTGAACATGCTATTTTGGGGGGCTCCCTTCACCCCCGGGAAGCATAATTCCAGGTTAGAGGTCCGATAAAAAGATTGCAGCTGGCG
CCCGAAATGCGTTCCAAGACAGTCCGCCATCCAACCTGCTCTTCGGAGCCGCGGTGCTGAGGCGCCCATTTATGCCCGCCGGCATAGTGGGAAGTCTCAT
ACCAATCCGGGGGACTGGGATGGGTACACACGGCGATAAAAGCCGGCCTAGCCGGGTCGTCCATCCTAGCCCCGGGCTTGACACCGTGTAATGGGACCGG
CCCATAGTGTGGTAACATGCTATTTGGGTTTCTGTGCAGTTACGGCTGTGGCGGACACTTTCCAATCAAAAGGACGAGTCGGCACTATTGTGACAAGTGA
GGACCGCTCGACGGTGGCCATTTGCAGTGGTACCGGTGGAAAACCGTTGGTTTGGTGCAGTCTGCGCTCAAACTCGGGGTTTGTACGGCCCTTTAATGCC
TATGATGCCTTGCTGCTAAAAAAAATATTAAAAAAGATTCCCAAAAAGCTGACACGTGTCCCTTTACAACCAAAACGGTTAATTGCCTGAGCTGATAAAG
CTCAGTGGCATTGAGCGCGACCGGTAGACCTCCGTTGCCAAAGGAAGCAACTAAAAGAAAAGAAAACAAAAAATTGAGGTACCGAGTCGCGCTTCAGCAC
CTCGAACCCGCAGCTGTGTCTCCAAAGGTATTGAGACGCAGCACCAATGCGGGGGTGCTTTAAAGGGATAACGGTGGATGTGAGGGACCAGAAACAAACA
AAAGCAAACGCGGCAAGGCTAATGAGGTGTTTTACAGCCGTGCAGGACTCGGGTTCGTGGCGAGGACTGTGCAAGACTGGTGGTGCTACACGGGTATCCT
GCAGGTGTGTCTCCAGAAGGCGTCTCCTTGCGAATTGCGAGGTACCGGCCGTCCTTTTACTAACGACTGCAGTTTTGGGTGGTTGTTTTCCAATGCACGT
GCGCATTTATTGGGAAGTCCACTAACGCTGCATTTGCTGTTGCAGTTGTTGCGGACAGCACCATGGTGAATGTCGGCAGCAAGCGGGAGCGGTACGGCTG
TTTCTTGGTTGTTGTCAAGTGTCCCTTGCTCAGTGGTCTCTTTTGTTAGTGATGAGCGGCGTCAGGAGCTGGACCAGCGCCATACCCAGGCCCTCGATGC
TAACGCGTCACCACAAGGATATGAGTCTCCAGCGTCTAAGAGGCGACGGTTGGGGCGCCGCCGCGCGGCTCAAAGGCGGTTTCGGGTGGCAATGGAGCAG
ATGGAACAACTGAGCCTACAAGAGGCGGCCGCAGGTGGAGGGGACGTCGTCACAGTGACAACGGGTGAAACCGCCCCTCCTGTGCCGACGGTCGTTGGAC
AAGGGGCGACTAGCCAGCTCTCTGCAGGTGCTCCAGTGCAGAGGGCGACTGACCCACAAGCAAATCCACGTCGGATGAGGGAGGCGCAGCGAGCGCGTTC
CAGACGAAGTAACATGACCGACTCTCAGCGGGAGAGTGCGCGGCGGCGTGACGCGGAGCGAAAGCTAGCCCGGCGAGCCCAGCTCCGTGCCGAGCAGCTT
CAGGACGTACGAGAGCGAAACCGGATCGCACAGCAGGAACGTCGGCATAATCTGAACGAAGAGGTCCACGCCGCGGAGCGTGAACGCAACAGTGCTTCTC
GCGCGCTTCACAGGAGTGTACACGATTGCACTGAAGAACGGATGGTAAACCAAGAGCAACATGCCCAGCGCCGATCACAGCTTACGCAGGAGGAGCGTGC
TGAAGCGCGAAGGGTAAACCAAGAGCAACACGCGGAGCGCAGATCACAGCTTACGCAGGAGGAACGCGCCGAAGAACGCATGGTAAACCAAGAGCAACAT
GCGGAACGCCGCAGAGAACAGACTGAGGAAGAAGCACTGGAGCAACGCGAGAGAGAGCGATTTCGGCGTAGATCGGCTCGACGTGGAGAGGCGTTGGCAA
ACCACGACGATTTTGACGTGGCCTACGTCCAGGGTCCAGACGTTGTGAATGGGCGCCATCGGCTTCCTCCCACCACTGTTTGTGAACATTGTGGCGCTTG
GAAGTGGCCTGGCGAATCCAAAATGAGCTGTTGTCTGGAAGACAAGGTTCGTCTTCCCCCTTTACGGCCTGCACCTCCAAGATTGTTGCAACTGTATCGG
GATCCAGCGTTTCGACAGCACATACGAGCGTATAACCAAGCTTTTGCGTTCACGTCCATTGGCGCTTCGTGCTCCAACCGATCCTTCCAGGACGTCAATC
AGGATGCAAGCGTAGCGGGACAGAGGGGCGTGTACACGTACCGCATCCAGGGTGCAATGGGTCACTACTTGGGATCTCTACTCCCCTATATTGATCCCGC
CACCGGAGAGCGCACGGACCTAAATTCGCGCAGATCTATATTGTGGACCCGGACATGCAGCAGCGCGCCCAACGCCGCAGAGGAATTTTTGCTGACTTGG
ATCCTGTGGCGTTGATGGACATTGAGCAAATGATGGAGCAGCACAACCCATTTGCTCAGCAGTTCCTGAGTTTCGGAGAGCAAGTGCGCTCGCGAGACAC
GAGCGACGTCGTGGATATGGTGTTCCGCCTCCACGAAAATATAGCGCATCCTCGGACATACAATTTGCCAACCGTTTCTGAGGTAGGCGCGACGCTCATC
GAGGACGGCAACCTGGATAGGCCTCGCGATCTACTACTGTATACTCGGGATCACAGGCTTCTGCGACTGTTCGAGACGCGCCCGGAGTATGATCCTCTTC
AGTACCCTCTTCTGCTTCCGTATGGGGAGCTGGGTTGGACCTACACAGACACATACGCGAACGGAGTCAGACGTCGCAACAAGAACCAGATGTCCCTTCG
CGAACATGTCGCCTTCCGGTTGCACCAAAAAGTGGGAGATCAGTCTGCTCTTCATCAAGGCGGCCGTCTCTTTCAGCAGTGGTGTGTCGACCAACGCGCT
AAATGCGAGCAGGAGCAACTTCGCTGGGTGGCCTCACATCAGAAGCAAATTCGCGCCGATCAGTACCGAGGGCTTCAGGACGCACTGCTGAACGAAGGTA
CAATTCAGCTGGAAGCAGGCGAAGGGCTACTCTCCGAGTTTGACAGAGGCGATGGTACGTTGGTCCACCCTGATCGAGGCCGTGGTGGTGATACCCATTT
TCTCAACCAAGTGGGACGCCGCGTTATTCTGCCCTCATCTCATATGGGCAGTCCTCGAGCAATGTACCAGTCCTACCAAGACTCAATGGCCATTGTTAGA
GAATTCGGCAAGCCTGATGTGTTCATGACAACGACCTGCAGCCCTACATGGGAAGAGATAGTGGAGGCCCTTGGGTCCGATCAACAAAACGCTCAGGACC
GCCCCGATATTGTAGCCCGTGTCTGGCAGCAAAAACTGCAAGCTCAGCTTAAAGACCTGAGCGAAGGAGTGCTGGGCCGTATGGAAGCGCGGATTTACGT
GGTCGAGTTTCAAAAGAGAGGGCTCCCTCACGCGCACATCTTGATCATTTTGGCTGAAGAGGACAAGCCGCGTACTCGCCAAATCGTAGATCGTA