Description :
From Genome Similarity Track
Location :
Scaffold_20:7936- 10956
Transcript NameFunction/comments
Phyke_g1236hypothetical protein PHYSODRAFT_492063
Phyke_g1237hypothetical protein PHYSODRAFT_313186

Sequence
3020 bases(100 bases per row)
GCTCCAATCGCGTCCTACATATATACAGATAGCAACAAACGATGAGACTCTGCAACCTACACGCAGGCAGGCGACAATATCAAACGTACCAGCCGATCAG
CGTCCTGTACGCAGCCGTATTCAACGGAGTACGACCTCTGGCGAATCCAGTCAGCAAGTGTTGTTAGTCAGCGAGTATTCAACTCCTccaccacgaccag
cacAATGCACACTAGTAGCTCGTGCATCAATGCAATACCAACCTTTTCGCCGTCTGCCAACTCCTCCTTGAACCCCATGCATTCGATAATAGCCATTACA
CGCTCGATCTTGTCGCTAGAAACGTTCTGTGAGTCCAAGAATTCTATCGCGCGCTTCGTGGGCTTGCTCTTGTCATACTGGTACTTCCAGTCGTCGATAt
catgcagcagcgccgccagGTCTACAATCTCCAGATTCTCCTCCGGCACACACTGCAAACGTTCGCTATGTTATCATACTGTCTGTATCCACACCACCAG
TCTGCTCCTTGCACTCACCTCCTCCTTTGCCAGCGTTCGCGCCACCGTCCAGACCCGCTCAATGTGACGCCAGTCATGTGACGCGTCGTtcgccttgagc
tgctgctccacaaaCGCTGCTGTGCGCTGCACCAATCTAGACGTGGCCATCTGGTATCGTTTAATACTGGAAGTGTGCCACTGGTTCGAAGCAGATTGAA
AAGTGTTGTGGTGACTCACGTGGTTGGTAGGTAGTTAGTCCATATGGACAATTCAAACCCGCCAATCTCAACTTCACGTACgcttttggcgccaaaatAT
TCCAACTATTGGATAACCACAGAACGGCTGCAGCTCTCTAATCTAAAGGGGGAAGACAGCGCGGGATGGAGTTTTACAGCATAGAGAGCTTTCCCTCAGT
CTGACATGGACATCACCGCCAGTTCATCGAATGAACCACTTCAAACCGACGTCGCTGGATTGCCCACGACTAAAACCCTcaagaagcccaagcgcAGTTC
CTCCGTGGTTGAACGCGACGCAGGACTGCTCATTTGGTTGACGATGAGGCTCAAAGGTGGCTCCCGTGCGTGGCCTCGACGTCCACGCATTCGCGGATGT
GAATAATGTGCGAGAAGGAGGGCTCTCAAGTCAGTTCATCTTCAGGATGGTCGCCACAAAGGCGGATACGAAGAAAACCCACGCCAAGGTTGTCATTATT
GACAACTACGCAAAGTTCACAGGGTCGAGCACCatgactgctgcagcaatagGAATTCTACTCTATTGACCCCAAGATGAATACGCTCATGATGGAGCGA
AGCGGACGTCCCGTCCCAACCAAAGTAAGATACGCTCTTTAATAGCTGAATGGAAGCTGGTTGGTGGTTCGACGATGAGGTCATGCGCCAGAGATGTGTA
GTAAATGGCCGCTATCACCTTGGCCTTCAACAGCGACGCTGAAAAGCGACGTGCAGTTTTAAATTCGCATTTAGCTCCAGTGAAACCCCCGTTAGTCCCA
GTCCCCAAgaggcagcaccagctccatgagctccCGCGTTAGCTCTAGCAGCTCCCGAGGCCCGAGCTATGTGTCCGCcagcaagatggagaagccCCGC
AAGATCACAGCCAAGGCTGACGAGCTGGACACATACATGGAGAAGCTCTACGACGACGATGTGGAGTCCAAACTGGACGGAGCCAAGATGATCCTGCAGC
TGGCAGAGTTCGCTGGGAATATCGAGGCGCTCGTGCAGAATGAAGCGCTCATGGTGCGGTCATAGTTAACTAAAGTCCATGCAAATTCTTCATATTACTA
CTGTTCTTGTCCTATGGCTGAGTTACTGCTATGCTGTATTGCTGACCCCAGAGCCTGCTGTCGCGCGTATTGAACGACGACTACAAGAAGAGCTACGACT
TCTCGCTCACGATGATGCGCATATTCTGGTGTTTTTCCaacttcctgcagcttcatccgATGCTGGCTAACTACCGCATTGGAGCCATCACACTCAAGAT
CATCGAGTTTGAGTTGAAGCGCCACCAGCTACGtcttgaagaggagaaacttctggaggctgcagccttAGAGCCCCCAATTCATGCTGCTAGTGATGTC
TCGACCAAGGAGATTGTTGACAAACTCGACCGTGAGAAAAAGCgcaacaagaagcgcatgaagAAGCAAGACCAACTACTGTGAGCATGCCAGGAATTCT
TTATATGAGCCATGCCAGCGGATTGATGTTCGACTATTGTTACAGTTATGTGTGCTTCAGCGTGCTGCTAAACTTGGCTGAGGATATCCATACGGAGAGG
AAAATGGTGAAGCGCAAGATCGTTCTGTTCCTAACAAAGGTATCTCTGATGCATCCTTCGTTAACTCTGGGGAGCATACGACGCGTGTCGAACTGATTAT
TGCCGGGTTTGTGTTTGGTATTTCTCACATAGCTGCTAGATCGTGTGGCGCCCGACCTAGCTATCCTCACCATTACGTTTCTCAAGAAACTAAGTATTTT
TGAGGAAAACAAGGACGCGATGGTGGAgcttgctgtggtggaaAAACTTGTGCGCTACGTAAACTGCAATCACGATAAAACCATCCAGACAGCACTCAAG
CTGCTATTTAATTTGTCGTTCgatccagcacttcgtgAAGTACTGGTGCGAAACAGCCTAATTCCAAAGCTCGTGGAGTTGCTCAAGAAGCCGCCCTTCC
GCGCGCTGTCCCTGAGAATTCTCTATCACCTTAGCATCGACGACCGATGTAAGTCCATGTTCACGTACACAGAGGCTCTTCCAATCGTCATGCAGCTCGT
GATCAACTTCCCGCAAAACATTGTGGCGAAGGAGCTTGCCGCTTTGGCTGTGAACCTTAGTCACAACGCGCGCAACGCCGAACTGATGTGTCAAAACCGT
GGACTCGAAGCGCTTGCCTCGCGTGTGTTCCGAACTCGCGACCCACTTCTTATGAAAGTGATCCGGAACATATCACTCTGGTCCTACACCCTCCAAGAAG
ATCTGGTGAGCGATAAGACG