Description :
From Genome Similarity Track
Location :
scaffold_9:793550- 795612
Transcript NameFunction/comments
Plaha_PHALS_02692glucose-regulated protein
Plaha_PHALS_02693Kinetochore component

Sequence
2062 bases(100 bases per row)
CCGTAACCATGTGAAAATCTTTAAGAATCGTTTAAATCGTGGTCGCACGACGCCCTCTGTAGTGCATTTTGATCCTACAAGTCAAAGTGTGGATGTGGGT
CAAGCAGCTATTGACCTTGAAACCTCTGAGCCTGTGGGGAACACCATTCGCTCAATCAAAAGACTCATGGGGCAGAAATATGAAAGCAAAGCGACTGATG
TGGCCAGGATCTATGCTTCGTATGAAGTGGCGCCCACAGCTCAGAAAAACGTTGCAGTTCAACTTGTACGAGGTCATAAAAAGGTGCAGGTACAGCCTGA
AGAAGTCTCGGCCTACATCTTGACTGAGCTTAAGACTTCTGCCGAGGCCTATTTTGACGGTCAAACACGCTTAAACAATGTAGTTATTACAGTACCAGCG
TACTTTAGTGACGCACAGAGGAAAGCTACGATTACCAGTGCTTTGATGGCAGGATTTAAGGCCGTTAGACTGCTTAATGAACCTACAGCGGCAGCGATGG
CGTACGGATTATTTTTGTCGGGAACCAAGTTAGTGACAGTATTTGATTTTGGAGGAGGTACACTTGATGTGTCGTTACTACGTATTCAAGATGGCAAATT
TGAAGTATTAGGTATTGGAGGGGATACGAATCTGGGAGGAGAAGACATCAATAATTTGGTGCTGGATCATGTACTTGAAGTGCTAAATAAACGTCATAAC
GTGATACGTTCGCAAGTTACTGGAGCAGATTTAGTGCGTTTGAAACAAGAAGTGGAAAAGCTCAAGATTCAATTGTCAGTAGAAGAGTCAGCAGATGTGA
TAGTGCGTGATCTTGCTGGTGTACCGAGGGTTACAGTCACACTTACACGACGCAAGTTTGAACAACTGTGTGACCCTATCTGGAAGAAGTTGGTGATTTG
TTATGAAGGTCTTAACATGTTGAAAAAATACTAACTTTCGCTCTGCCTTTTAATATAGATGTCTTCGGATTATGTCAAGTGTACTAAAGGAAGCACAAGT
CGATGCTGCTGACATGGACGAAGTTATTTTGGTCGGTGGATCGACTAGAATTCCTTGTTTGCgctcaaaaatatcaaaagcttttcatgGCAAAGTATGT
AAAAGGTAGAACGAATTATTAACTACATTTGCGACTGACCAGCTCTGTGGTTGTTACTGTGTTAGGAACTTTGTATGTCTGTAAATGCAGATGAAGTTGT
TTGTGAAGGTGCTGCTATCCAAGCTGCAATCTTGAGTGGTATCGATCAACGCGTGTTCCGTGATGTACTTATGATGGATGTCCTTCCGCTTCCTATCGGG
CTTGAGACGGCAGATGGTACGATGGAGGTGATTCTCCCTAGAAATGCACGCATTCCAACGACAGTGACGAAATACTTTACGACCTACGAGGATAACCAGC
GTGGAATAACAATTGAAGTCTATGAAGGCGAAAAGGATATTGCTAAGGAAAACGATCACATTTGCTACTTTAACTTTGCATTACCTCGGAACAAGATTGG
AAAGGCGGGGGAATATTCGCATCCCGTCACCTTCACAATGAATGCAAGCGGTATTTTACAAGTGCAGGCTGGAATCCACCATGATCTTGAGGAATCGCCA
ATGACGAAGACTGCCATATTTATCATGGGAGCTTACATCTTCGCGCTATTTGCCTTCTACGTGTTTTTTCGCATTTACTTTGTCAACGAGAGAGATATCA
CAACATAACGCACTCTTCAAAAACTCGTCTTGAAAGTTCCAAATCATTCATCTTcacaaaattgttttgaCGCTTGATACTGTGTCAGATGTTCTGACGT
TGAAGAAGCCAAGTACGCGTCCAGTATTTCCCAGCGTGTGAGACTAGAAGCTCCTACCTCTTGATTACTATCAGACTCAAAGCAAGCACTTTTCTTTATT
GACGGGGCTGTTGATGGGTGATACTTATAATAGAACTCCACCGCCTTTAAAGCTGCCTCCATGCGCTCGTCAGCCAATCTGTATACCAGACTGAGGTAAG
GAGACAAAACTGTACAAAGCAAGCTGGCGCAACTTACAATAACGAGACCAGATAGTCGATGC