Description :
From Genome Similarity Track
Location :
Scaffold_1:793544- 795206
Transcript NameFunction/comments
Aphas_H257_00270Hypothetical protein

Sequence
1662 bases(100 bases per row)
GCGTGTGACAGGCGGACAGGAAAGCCCAGCTGAGCGATGCGAATGGCGTCGAGTATGCCGTGGCACCTGAGTTGGTGGCGCAGTCGATCGGTGAGGAACA
ACGCGGGGTCGGCGGCGTCGTTGGGCTTGAGACACCGGACGTAATGCACTTGCGCAGTGTGCAGCCGCTTCATGAGTGTCCCGAGCTGGCTTTGGAACTG
ACTCGCAACACTCTCGTGGCGCCGGGGCTTGTTGTGCCTCGACGGGGACGACGACTGAAACAACTGCCGGACAAAGGCGTCGGTGCTCCTCCGGCCCCGC
AGCAACTCGACCACGTCGGGTGCCAACACGCCGAAGTTTTTGTCGCGAAAGCCCACAGCGGTGTACTCGACCGACCCCGCGTAGTGGTGGATTGTAAACT
TGCGCTGGCTGAGCTGGCCATGAGACGCGGTGAAGCGACGGGGATGACGGGTGGCATGTTCCTTGTGCAATTTCGAAGCGAACGCTGCGTCCGACCCACG
GGCAAGGACGCACTCTTCGTCTAAAAGTGCAAATAGGCCAGTGTGTTTGGCACTGAAAAGGGCGATGCAGTCTTCGTTGTCGACATATGGAGTCGTACTC
AACGGACATGCCAGCCCTTCCGCGGCGTACTCTGCTGCGTCGAGCTTGAACACGTGCTGGACAAAATGCTGGTGGAGCACTTCGTTTGTGTAGTTGATGC
AAAGCTGTTCAAACGAGTTTAGACCAAAATGCTCAAAGCCAAACATGTCTAGCACTGCAATCCATGACGATGGCGATGTAGCTGTTGATGGATGTGATAG
GTTGAGGCGGCCGTTGATGTGTTCGACGAGCCACTCAAACAGCCGCGCGTACAGTGCCTTGGCCATGCCATCCCGCGCTTGCGCTGCTTCCACGGCTGAC
AGCGACAGAACTTGTACCTCGTTGGCGACCACCAGCGCGCGGGTGGTTAATGCAGCTTGCAGGTCCGGCAGCGGCACTTGTAAAAGTGCCGCCGCCGCCG
CCATGGCGTGTGTCGATACCGACGAGTTGGTTTCGTCAAAGGACACGTTGCCCAGGTGAAGGACAACTGCGACAACACGGTAGACATCGGTGGCTGGAAG
ACCTAGCGACGTCATCGCAGTCTCTAAGGCTGTGAACATGGCGCTGTCATCATGTAGAAGGTTTTGTTTGCACGAATTGCTGCTGGAGGGATGGGGGATA
TATCGAAAAGTGTGAGTGGCAACACCACGGAGTTTGCTATTGCCGTGCAAGGTGGAAGAAGTTGGAGTGGGAGACGGGACAAGCTGCCACGTGGCAAGAA
GCGACGAGGGGGCTCCACTGAGGAGGGCATAGAACACGTGGTAGTTGCGCTCGGCGGCGGCGGGGTTTACGATACGCACGGTCTCGAGGAGGTACGTTTG
GATGGAGGCGCTGAAGAGGCGATGGCTGTCTCCACTGAAATCCAGCTGGATGAACTTGCCAAAGCGACTGGAGTTGGAGTTGCGGAGGGTCTGCGCGTTG
CCAAACGCTTCAAGCACGACGTTGGCGGCGACGATGTGGCGGGTCAGCCGTTCCGACGACGTGTCTGAGGATCGACCGACGTGCACAAAATAATCCAACA
TGCGCTTGGTGCACTCGGTCTTGCCGCTGCCACTGTCCCCACTTATGAGGATCGTCTGGTTG