Description :
From Genome Similarity Track
Location :
Scaffold_56:79352- 90070
Transcript NameFunction/comments
Hyaar_Emoy2806839hypothetical protein

Sequence
10718 bases(100 bases per row)
TGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCTGCGAGAGGTGTGGACTGTTAACGGCCGTGCGTAAGGATGCATGGTCCGTGTAAACGATGAAGGGTATATCACCTAGGAGATAGA
CCCTCAATTTTGCCAAAGCATGCTTCATGGAAAGGAATTCCTTGTTGACTGGGTAGTTACGTTCAGCCGGTTGCAGCTGACGCGACTGATAGAAGACGAC
ACGTTCAGCACCGTCTGTGTCATACTGCATTAGTGCACATCCGATGGAAAAATCACTTGCATCGCAGACCACATGAAATGGTCTGTCTTGGTCTGCAACC
GCCAAAACTGGCGAGCGTATCAAGCTTTTCTTGGTACCTTCGAAGGAGCGCTGGCAATCAGCACTCCATGCCCACTTTTTGTTCTTTTTCAATAAACGAG
AGAGATGAACAGTCATCTCGGCGTAATTGTGCGAGTATTTGTGCAAATACGCCGCTAGACCAAGGAACTTTCGAAGTACTTTCATGTCAGTAGGCACCGG
CCAGTCTGTGATCGCCTTGACCTTTTCCGGATCTGGCCGGACGCCGTGCTTACCCACGATGCATCCAAGAAGTGGTATTCCGCTTGCAGCAAATATACAC
ATCTTGAGGTTGGCATACAACTTATGCTCACGCATCAGTGTAAGAACCTTTCGGACGTGGAGTCGGTGGACTTCTACATCCGTCTGTCCATCCATAGCCT
GGCTATGGACGAACACGTCATCGAAATAGCTAGGTGCGAATTCTCGCACAGATCTCAACAGATACGTAACGCATTTGTTGAATGTAGCAGGGGCATAACT
CAGTCCTTGTGGCATTACTAACCACTCCCAAAGCATACAGCTTGGAGTGATCACTGCTGTGTAAGGAATGTACTTTTCACGCATAAGGATCTGATAGAAC
CCGTCCATCAGATCCATCGATGAAAAGATGTTACTCCTTGCCATACCATCCATAATGACATCCTTTCTTGGTATCGGCGTTTGAGCCGGTACAGTGGCAG
CATTCAACTTGTTGAAGGCATGTACTACCCGCCATCCTCATGTGGCCTTTCGGACACAAAAGGTCGGAGAGCTATTTGGGGAAGTAGATTCCCTCACATG
GCCCGCTGCCAAGCGATCGGCAAATAATTCGTCAATAGCTAGTACTTGTTCACGAGGCAAAGGCCATTGCTTCATGACACAGTACTTTGAAACTGGTTTC
AGGTCGATCTCGTGACGAGTACCCTTATCATTGGGTAGCTCGCACGGCACTGTTTCTGGGAACACATCTCTGAATTCCGTCAAATCATCGTAGAGAGGAT
TTGTCTTGAGCAATTCCCACGATTGGGATGTGTATCGCTCAATCCGAGTCTTCTCATCAAGGACACTCTCGTCCATTGATGAGCTGCTGAGAACCCTTTC
GTTATCAGCAAATACCATTGCCGACCGAATATCGGTTACGTACTCGTAATCCGCGACGAGTACGCAAAGCTGCTTGACTTTGCCACTACGCAGATCACGC
AAGAGCCTCTTCCGTTTGAGCGTGGGCAATTGAGTGATCTCCGAAGTTGTCTTCGGAGGCGCGATCAGATTAAGTTGGTAAGTTCCTATACTTGATCCGT
CATTGACTAGGACATTTAATGTCTCTGTTATCTCCTGGGAACTTATTTCCGCGGTTAGGTGGGGACTTATTCCCTCACTAGCCTCTTGAGCTATATCATC
ATACGACACGAGTGGAATTGCTCCCTCGTTATCCTCTGATGGTGGTTGCGCTACCGCGGCCAGGTCTTCTACGTGCGATTCTCCAATCGCACTAAGATCA
TCGCATTGCCAATCATTTGCATCGGTTCGTTGTCACTTGGGTGTTGTCCGTTTGGAGGACACCCACGCCCCAGTCCACTCGACTTATTCTGGTGGTGGGC
CTTCGGCGCGACCTGCATCTCAATGCAGTCGCCGGAAATCTGGCTTCATAATGTGGCGATCAGCCACTCCATGGTCATGTGCAGTCGTACTGACGACCAA
ACCACACGCGAGGTCATCGCACTCGTTCGTAGTACACCCACGTGTTAGTAGGCGCTCCATAGCGTTCATCAGATGGCCATCTGATGAACAAGTGACAGGC
ATATCGACTGTTCATCGATGCCAACTGACTTGTGGCTCGTACCTTCTGAGCCACGGCAGTTCAAGGATGACATCAAATTTGTCTTCTAAGTCTAACATGA
TGAAGTCATCATTATATTGGACTCCCTTCAGTGTATAGGTGATACCCACTACACGTTTCATCATTGTTACGGATGCGCCTGTCGCGAGGTGCACCGTCAT
CCTCGTTGGAGGGATCTCTAGCTCAACATATACGAGCTCTCCGATGTCCAGTGATTGGCGTCGTACAAAGTTGTTCGATACCCCACAATCGACTAGGGCT
CGAAGCGATATGCTTTGTGTCACTTCGACTTTCAAGGTAATGAGGGAAACCTCATTACCAGAAGCAGCAACACACAATAACTGAGTGTTGGGAGCAACTT
TCGTCAAGAGGCCTGCAAACTCGCTTGACGTTACTGGATCAGTAGGGTACTCCGCACCTACTGACCCTGACCGTTTTTTTTTGGCTGCCCGTTACGTTGT
TGCATTTTCACAACAACGTCGGACCCACGCCTTGGACCTCTCTTGGCCGCTTGGCGTTTACTGTTTCCTGCGGTACGTGGTACCGCGCTCGGGGCACTGC
ATTCATATGCATAATGCCCTGTATTTTGACATCTATTGCATTTCTGCAATTTCTTATAGTTGTTAACACGAGAGCTCTCGCTCCTCGTGTTACAGAGTTC
CATTGGTTCTGGGCTTCCATTTTCCTGTCATCTGGATGGACGATAGGAATTCGAATTCGCGTGAGCCTGTTTCACGCTGAAGTCCTCCTGTTCCGCAACC
CTTATGGCCTCTTCTAGGGTGTTGAACTCCAATCAGAACAGGTAGGTTTTAACAGAACCATCAGTCAGACCCTGCATGAACGACGTAATCAACGTTTGTT
GGTTCAGTGGGTCGACAGTTATGCAACTGGTAAGGTGACGTATGTACTAAATCCACGAGTGTACGTCACGTTTACCTTGCTTGATTCTCAGGAGTTCAGA
GCGAGCCCTGAACTCAGCTCGCGGCGGCTCAAAAGTTTGCCTTAGCAGGGACTTGAAGACTTCCAATGACCTAAAGACATATGGGTCGTGTAACTTAAGG
CCCAAGACCCACGCCTTTGCACGCCCTGCCAAGTTCGATTGAGCAAATGCGATCTGCATTTCCTCATCGACGATATGACTAGCCCTTATGGCATCGTCTA
CTTCCACGGACCATCTCAACAGAGAATATTCATAGGTTTGCTTGTACTTCGAGATGTCAATCTTCAGAGTCTCGGGTCGACGTATACACGTCGACCCGGT
AGCAGTGGCCTGCTGCTGTCTCAACAGCTCTTTCTGTTGAGAACCTTGTTGGTGAAGCAAGGTTACTTTTCCGCTCGGCGCCAAGTTCATTCTGAACGAA
CTTGGCGTTGGTGGCGTGCTGCCCGTCTGGCCCCAGGGCGGACAGCAGTGCGCCAATGGCTTCTTGCCCTATAGTTGAACTCAAGCGTTCGACAGCGTCC
CATTTGATTTGACTCAAATGGGAGTAGCTTTCATGCGTTGGATGAAAATCATCCCCCTCAACGTCCAACATATTCATGGTCGTTGAACGGACTACGAAGT
GCTACCAGGTGTAACGGG