Description :
From Genome Similarity Track
Location :
Scaffold_948:7935- 11655
Transcript NameFunction/comments
g14320.t1RAW42040.1 hypothetical protein PC110_g1784 [Phytophthora cactorum
g14321.t1hypothetical protein
g14322.t1hypothetical protein

Sequence
3720 bases(100 bases per row)
AAATCCGCGAGTTTTTCTTCAACGCGCGCATTTCAGCCGAGTCGAAGCTGGTCAACGAGGGGAAGATCCTGGCCGAGTTGTCGGCGTTGCTGCGTTCCAA
AATCGCCTTCGCCATCAACGACAGCGTGCTCAACAAAATGCCGTTCTTCGCCGGCGCAGACCACAACTTCCTGATGGAGCTCGCGCTGAGCATGCGCATG
GTGTGCTTCCCGCCTCTCGAAGAGGTTATCCTGGAGGGCGAAATCGGCGAGGAAATGTTTTTCATCTTCCGCGGGGTCGTGGAGATCGTCAAGTCCGGCG
TTCAGCTGGGACTGCTCGGCCAGAAGCAGTACTTTGGCGAAATGGCCATCCTCAACCAAAATTGTCTGCGTACAGCCACCGTGCGCACACTGTGCTTCTG
CGAGTTGCGCATGCTCACGCGCGAGAAGTTCCTCATCGCGCTCACCCACTACCCCGCCATGAAGCAGCGCATCGCACGCATCGTGGACAAGCGCACCAAG
ACGACGCCAAAGACACTCAGCTCCAAGCCGACCGAGAGCTCCTTGTCCGCGCTCGAGAAAATGGCCGCGTCCATGGTCATCGACGCCAACACCGCCCAGC
AGCTCGTGACCCCGACACCCGAGACCACGCTTAACCGCATCTCACAGCTCAACTCGGACTTCTCGGGGTCCTTCCGCTCGCAAACGGCCGAGAGCGAGCT
GGAGAAGATCCAGACCAAGATCAGCAGCATGATCCACCAGCAGGACCGGCTCGGGAGACTCGTGCAGGACCTGGAGAAGCAGATGCACGACGTCACCGAG
GCCCAAAACGTTTAGTCACAAGTTGTGGATTGTCCTCTCTACCTTGGTCTCTACTGTAGGAAAAAAAAAAACATCAGCAAGTAGTCTCGTTCTACCTCTC
GTCTATATTGTCACGTGTCTTCTGGCCTACATGAGGTTGTCGGCCTCGTCCGGGATCCGCACCGTCATGCCCTCCATCTCCTTGGTCACCTGAATCTGGC
AGCCCAACCTCGACCTATAGCACCAATAGAACCATTAGTGCACCACTCTACCATATGAAGTAGAACCGTTCTACCGCTCTACGCACGTGTCTGTGAGCCC
CCAGGCCAGGTCCAGCATGTCCTCCTCTTCCTCACTGATCTCCGGCAGGTCGTCGAAGATGCGCTTCTCGAACACCAGGTGGCAGGTAGAGCAGGCTAGT
TCTCCTCCGCACGCGCCCTCCAGCTCCACGTCGTTCTCGTGGGCCACGTCCAGCAGTGACTGGCCCTCGTCGGCCGTCACAGATGTATGCTCGCCCTCGC
CGTCCACGAACGTGAACGTCACCTGCGAGAAGCGGCGGCCACTGGGTGCAATAGAGAGAGAGGCGCGGAGACCACGCACAGCAGGAAGCGTGCGCGCTGG
ACGGCGGGTGGCCGTCAAGGCGGTGCGTCGCAGCAAAGTCGTCGTGCGCGAGGCGAACATGGTCAGCCAGGAAAGCGGTCTTATTGGTAATAATGAGCGG
CTGACGTACTTCTCGGAAATCGCACTTAGGATCGCTGCTTCCTCTCTTCCCAAGTTCCGGCAACATTGGCAGACAAGACCATGAGTACCTCTCATCGCGA
TTGCTAGTCCATACTGAATCGCGTGGGCAGGCTGGAACGACATCTTGCGCGAGCGGGGGTTGCTGTAGATGCTCGGCTTGAGCTTGCTCATAAGCGCCTT
CGTTTTGCGAGCCCGGCGTGTACTTTGAGTCCCTAGTATAAACCGTCACCACGGCCCTCACGCATCATAGCAATGCCTTCGTTGACTTCGCTCATGGGCA
TCTGCTGAACAATGGCGCGCACGTTCAGCCACATCCTACACATGAACAACGTTCTCGTCTTCGTCCTGCTCTCCCGGGGGGTTCATTTTCGTTTCTTCTT
CGTTGTCGTCGTCCTCCTCTCTCAATCGAGTAGCACATCGTTGCGTCCTCGTCTTCGTCCTGCTCTCCCGATGGGTACTTTGATTCGTCTTCGTCCTCGT
CCTCCCTCAAGTACATAACGCAAGCAGAACGCCTCGAGGCCCATTGAAGCACCCGTCCTTCATGCCAAAGCTGCTCGAACTCGCGGTTGGTCGAATCAAC
TTGCGTCTGACCCGTGCGCCTCTCAAAGGTCTCTCCGTGGCGGGCTCCATCGAAGGCAACCGCGCTATAGTTGCCCGAGCCTCCTAGGCTGAACTCGTTG
TTGACGATGGTGTACTTGTAGTGGACCATAAGGGTGGGCACGCGCCCAGTCTTGACCGGGATCCCCACGTCTTTGAACTTGTGTAGCCAAGCCATGTTTT
TGGTCTGGAGCGCGCTTCGCTCGTCGACAATCATGCGAACGACGCAGCCGGCTTCAAGCGCCTTCAGTATGGCCTCTCCAATGCGATCGTTCGTAATGGA
CATGTGGCAGATGTCCAGCGAACCCCGTGGTCTAGCGGCCAGGCCAAGATAGTACACGACCTTGTCCTCGGCGTCCGCGTCTCGAGAAAACCACCGCACT
GACGAGACGTTTCGTGCAGGGCAAGGGTCCTGCATTACGGGCGCCGGTAGAAGAGCCGGCTGACCAGCCTGCTCGAGCGGCACCACAATGCCACACCTTG
GCTGCAGGCTCTCCCCCCGCTCGTACATGGCATAGTAGTGCGCGACCGTTCGTCGATTCCAGCCGTGCTCCTCGCTGACGGCTTTAATGTCCTTCTTGTT
CCCGGTCCGGAGTAACCGCTACTGCACGGCTAAAACTCACCATCGCCTGGCGCTACAGATGAACATTACCGCGGCTATCTATCTCAACTTTCCAGTTGTT
TTGCACGGCAAAAGACCACATGTGTTCGTCAAACTCAACGGCGTGTGCTCCAACAATAGGACCACGCAATACAACAGTATGTTCCCAATTCAACGTCATT
CCCCCCACACTCCAATTGCAGCTTCCACGGTTCCATCGATAATCGCTACCTTCCAGTGCATGAGTCTGGGGCCTGCGTGATATACGTTGACCCCGTTTTC
AACCAGTTTTTTTATCATTGCTGAGCTTTTCTCGGTGACTTGTGCCCGATCAACGAGAACACGAACCGTGACACGCTTGGAGGCCCGGATGATAGCGTCG
GTCAGTTCAGGATGCGACAAGATGAACATAGCGATATCTACTGAGGTCTCTGCGCCGTCGAGCAAATCAATGAGCTTCTGAGGTGCAGCTTGGTCGCGAG
AAAACCAGTAGTCTACAACTGCAGTTTGTAGTCTACCCAATATGTCCTGCTCCATGCGGCCAAATACTCGACGGTCGACCCCCACTATCCCTGCGATGTC
CTTGAGCGATTGGGTTTGCGTGACGCTAAGACCTCGTTTCAGCATTTCCACCACGAAACGCATGGGGGTCCACCGATAGGGTTTACCGGACTTGGACTCG
TCTTGTTTGGGCTTGGCGTGGACGATGGCGTCGATCGTGCTGCGGGCGTGTCCCGTGCTTTGATGCAGCTGGGTAATTTTCTCCCCATTCTGGTATCGCA
TGCGAATCTGGGACTTCTCTGATGGGGTTAGTCGCGGACGGTGTTTCTTGGACAACGTACTTCGCGTTCTGTAGGCATTCGGCATGACGCGTCGCGAAGC
AGTGTACATCCGAACGGTGGCGAGAGCGATGTTTTCCGGTACACCCGGGACTGGCCGAGGGGACTCAGTTGCGAGCGCGGTGAAGTACTGGGGGTGGTGG
GGATGAGTTTCTATCGGGAG