Description :
From Genome Similarity Track
Location :
Scaffold_275:7935- 8938
Transcript NameFunction/comments

Sequence
1003 bases(100 bases per row)
ACTAGACCCAGAATGGTTTGCAGCCTTACGTAGACTGCGGGAAAAGGCTCCAACCTCAGTAGATATTGATCTTTTCAATACACGATGTTTGGATTCATTT
CAAAAACCAGATTGGGTTTCGCACGCGAAGCACATCGCCCACAAAAATGTAGATGTAAAATCAGCTAACGAGGACAGAATAAAGGTCGCGGACGAGGCGA
TAGTACATATTACATCGCAGCACTTCGTGCAACAAAAAAGATTGACAACCAAGCGGGACATCCCTGCCGGAACCGTCCGCGCACTCATAAGTGATGCAAA
CGTAGCCAATTCAGATCGCGATCTAGTTGTTGCTAGCAAGCTAATCCTTTGCATAGGAGTCCCGGTAACTTTGACTTTTAATATGGCTCAAGGTGCTGGC
TTATGCAATGGAACAAAGGCTATAGTTTACGACTTCATGTTTGTGACCGGCAGAGAATTACCAATCGTTCTTGTACAGATCGTCGATGCCTACTTAGGGC
CTTCGATACTGGATGATGTTCCTAACATTGTGCCTATTGCACCGAAAGATGTATCATGGAGTAAATCCTCAAGCGACCTTGGCGTTGTCCGAAGAGGAAT
CCCTCTTCGACTGGCATATGCAATGACAGTGCACAATGTGGCGAGGTCGATGATACCTTTACCGCCCAGGGGGGTTCGTATAGCGCGCTCCAGGTATTCC
TCCTATTGAGGGTATGGAGGGCTACCGGTTTGGTATCGGTTGTTGACCGTGAACCGGTTGACCCGAACAGGTCCAATCCGAACCTACGCCGATTACGCTA
CCGCCGATTACGCTACCGCCGATTACGCCACTGTCGATTACGCCACCTGTGGGTACAAGATTGTAGATACAAGATGGCCTTCGACGTGGCTCTCTCTCAT
TGGCTGAAGTAACTCAGTATCCAGTAAAGAATCAAGTAGTGTGTATCAAGTAGGTCTAGAGTAGCGAGGAGGCTAGCGAGCTAAAGATCCAATCAATCAC
TTT