Description :
From Genome Similarity Track
Location :
Scaffold_893:7934- 9273
Transcript NameFunction/comments
Phymu_g12280hypothetical protein

Sequence
1339 bases(100 bases per row)
AATTTGATAAGTTTGTACGGATTCCAGGGGGAAGAAAATTGACAGGTCAACAAAATCACGCCCTGATGAAGGAAGTAACGCTGAACGAAGTAGTGCAAGC
CTTTGGCGCACTAAATAGACACAAAGCAGCAGGACCGGACGGATTGAACAATGACTTCTATAAGGACGCCCAGGCTCTACTGGTTCAGCCCATGATCAAT
ATAGCGAACGAGCTGCTACAAGGAGGTACGCCGCCAGCTTCGTTCTTGCAGGGAATGTTAATCCCATTACGGAAGAAAGGAGATTCAAACGACGCTATGG
ACTACAGGCTGATCGCGTTGCTTCAAACAGGATACAAAATATTCGCGAAGATCGTGGCGACTCGGGTGCAGGAAGTCCTTGGCGTTGCAATAGGTGATTC
TCAACAGGGATTTGTGCACGGCGGTCAAATGCTGAAAACGGTAATGATGATGATGGCAGTATTAGGAACGGCAAAGGATGAACATGACCTGGACAAGGGT
AACAGTAGAGCGATATTGCTCCTCGACTTCCGAAAAGCGTACGACACGGTGGCTAGAGATTTCCTGTtcatgacgctgcagaaaTTTGGCTTTCAGAAGG
AGTTTATTGATATGGTACGGAAACTACACCTGGGAACAACAGCGCAGTTTTTAGTGAATCAAGAACTCTCACAATCGCTGCCAGTAAAGACTGGAATAAG
GCAAGGCTGCCCACTAGCGCCATTGTTATTCATCTTGGCCGCAGCAGTGTTGTCAATAGCACTTAACGCGGATCAGGAAATCACGGGGATACAGATCCCA
CACAGTAACGGAAAGCGGCAAAAATTTTCTGCATTTGTCGACGACTCAACGGTGTTTGTGCAGCAAGCCCAGCAAATACCGAAGGTGTTACAAATTGTGA
AGCAGTTCGGGGACTTAGCCGGATTGCGGGTTCAACCAGCAAAAAGCAAGATTATTTTTCTTAATACTGCAGTATCTCCAGAATCGTTCGGAGGCATATC
AGTACTGGCTCATGGAGACACGGAGAGATATCTTGGATACGCGGTAGGAACAGGAGATATGACGACTGTAAATTGGGCATCCAGAAATTCGGGGAGTGCT
AGCAACAGCATCGCAACTAGGAACCAGTGTTGAAAACAGAGTCACGATTCTTAATGTGATAATGTTGCCAGCAGTGTTGTTTACAGCGGCGGTATTTGAT
ATTCCGGAGTGGGCGGAGAAGCAATTGAGGAACATCCAGAAAAACTTCTTATGGAAGTACTCAACATCGACGGAGCCAGCAAGCCACAAGGTCAATCCAG
AATTGCTGTTCACACCGAAGCAGGCCGGAGGTGTGGGGC