Description :
From Genome Similarity Track
Location :
contig_22:793230- 794623
Transcript NameFunction/comments
g4872.t1hypothetical protein

Sequence
1393 bases(100 bases per row)
AGCCCACCTACATCCTGTACACTAGCGCCTTGCTCGCTTTCGTGCTGCCGCTCCAGTACGGTTGGTCGACCTCGCAGCTCAACCTGCACAAGTTTAACAA
CGTTGAGGATTGCAACGCCCGTCCGGTTGCCGAAGACACGTGCATCATGTTTCCAGGACACACCAAGTTCCAGTGGACTATCGTCGTGAACGCGTGGATT
TTTGGAGGTATGATCGGTGCCGGTCTCGTCGGCAAGTTCGCCGACAAATTCGGTCGCAAGCAGGTCCTCATCTACAACTGCGGCTTCATCATTGCCGGTG
CTATTATTATGGCTGTCGTGTCGAACCTGTGGGTTCGCAGTCGGCCGTCTGCTTGCCGGTATCGCGTCAGGCGCTACGACGGGCAACGTTGGCGGCTACA
TCAACGAGATCTCCCCGCCTCACCTCCGCTCGCTGCTTGGTGCCGTTCTCCACAGTGGTATCACTGTCGGCATTCTGTGGTTGCGACGACGTTCTTCTAC
ATGGACTTCGACAACGGTTGGCGCTACATTGCTGCCTTCCCGATCGTGCTTGCGGCTATTTTCTGAGCATGTCCCCGTTCCTGATGGTGGAGTCGCCCGT
GTGGCTCCTGCTGAAGGGCCGTCGCGCGGAAGCCGAAGCTGTACTAACGCGTCTGTTTGGCGCTGAGAACGTGCCTGTGGCTCTCGAGTGGATCGAGTCG
AAGCGCAAGCACGATATGGAGATGCAGTCGAGCACGTGGAGCGAGACGGGCAACGAGGTTGTTCGCAGTGGAAAGGGTGTGCCTTTTCGGAGCTGATCGC
TCCCCCTCTTCGTCGCCAGTTCATCATTGCCATTGGTGTTGCTTGCATGCAAAAGATCACGGGTATCAACACGGTGTTCTACTACTCGTCGGATCTGTTT
AACCAGGCTGGTCTGAGCAACGCTCGTGTCAGTACCATCATTATCGACATCGTGAACATGCTGCCGACGCTGGTGTCGGGCTTCTTCGCGGCACGTTTCG
GAAACCGCCGTATGCTGCTGTGTGGTCTTGCTGGCATGTTCGTGAGTGCCATCGGTGTGACGCTTTCACTGTCGTTCAGCTGGTCGGCATTGTCGATTCT
GTTCATTGCCACGTATGTGGGTTCGTTCGGCGTGAGTCTCGGGCCGCTCATGTATGTGGTCATCGCGGATATCTTCCCCGACTACGCTCGTGCGACTGTG
ACTTCTATTGGTGTCATGGTTGCCTGGACGGCCAACCTGATCGTGGGCGTTGGATACCCGTACATTTCGAGCGCGCTGGACGACCTCGCGTACCTTCCGT
TCGTAGTGCTGCTGGCGATTTCGTTCGTGTTCGTGCTCGCCCTGCTCCCGGAGACGTCTGGCAAGACGAACGAGGAGATCCAGGACGAGTTCC