Description :
From Genome Similarity Track
Location :
scaffold_86:79322- 83057
Sequence
3735 bases(100 bases per row)
TTATAGTTCAAGTAGGAACAGTACGTGTGCGGCGGCAAGCGATAATTTCGTCGATGGCATTGCCAAATCGTTCAATTTGGAGCCGAGTGCTTGGACAACC
CGAGGATCGACCTGTTGCAATTGCCTCTTGTCAGTTCGAGGGGATCCAGCCCAGTCTTGCAACCACTGCAGAGCCAACCAAATATCACCTTCGTCACCAT
CTAGAAGTGACAGAAATGCTGTACATAGCGCGTCACGTGCCATTGTGGACAGAGTTTCCATGCACGGAGTCTTAACTATCGACATCGTACGCCGTAGCAA
CGCCAAGTCATCTTCGACTATACACAACCGGAACGCGAGCTCGAACTCGCCGCATTGAGCCGCCTCCAAAGCAGCTTCAGCCCGAGTGAGCTCGAAGCTG
TACGCTGTGTTATCAATGTGGTTGCCATCTTGGCTACGCTGCGAATCTTCAGTTGTCCGAGACGATCGGTGCTTAAGAAGTGCTGTATGAATGACATCCT
CGTGCTGTCCACGTCGAGATCGTAGCTGTTCTCTCTGCTTGGCTGCGAATTGCTTTAAAGTTGTGACGGATTGTAGAGCCTCTGTTGCTGGTTGTGTCCG
TGCAGATTTGTCAGAATTCGACGCTAAACCGGAGCTTCTGCGCTGTTTGTCTTGGACTTCACTCTCCTCAATTTCGGGGTGCTCAGTTTCATCGGCATTT
TCTGGGGCAGAATAGTCCATAGCCAATTCCGTAAAAATATCATCATCTTCTGCAGGCTGAAAAACTGGAATACTGGCCTGCACAACTTGTTCATCAGGAG
CCGCTTTAACTGTTTTGCTTGATCGAGCAGCAGACAGTTTGCGTCGGACTGGTGCAGGGTCTTCATCGAGAGTAACTTCATCTGTTGGCAAAGCCTGATC
ACCTTCTTCATGATCGAAACTCTCCACATTTACGTCTTCTGTCGAGTCGGACTGTAAAAGACTCGAATTGATCTTCGATTCATTCGGCAACGAAAGGGAA
TCATGAGCGCTGGTCTCCATAGGCTTCGCCCATCGTTTACCAGTAAACGAGTAGCCTGGCGGATTGGGCGGAACGAAGTCGTAGCTGGCAGTCGGTTTAG
CTTGGAGCTCGCTACCTGTCGTTGGATATTTTTTTTCCAGGCATTCAAATGCCATAGTCGCTGGGATAGCAGCTTCGCGAACGAGAGACACGGAATCATG
GCGACCAGCTAGAACGAGAGCTCGAACGCGCTCCTGAAGTAACAACCAGGCAAGGTAAGACTCATTTTTGAAAAAGGAAAACAATAAAACCTACCAGTTG
TGCTTGAAAATATTCTTTTGCACCGTCAACAGAGATACACCAAGCAGATTCCTGCAAGACGAATGTATCGAGCAGTAGAGTTAACAACTCCAGGCCCCGT
TTCCGTAGCATCCAGTCGTCCCGAGGTCCACATTGGAAGGCATCTTCGATTGCTTCGTAGATTGAGCCGATGTATGGAGTAAAATCATCTCCAAGCTGCG
TAAAACCTCCTTTTTCGTGAGCATTTCGTGCCAATTGGCAGGCCGACTGAAGCAAGAGGAACAAGGGGGAGAACGTGGGGAACATCGTACTGCCATCCAT
TTTCGCTACGGTATCTGCCAGGAGAGTCTTGAAGAACGGACGGATTCGTGTAGCATGAGCGAGAATTGTACTGGGACCCGGTACTGAAACTCCATCAAAA
TCGAGGGGATGGAGCAAACCACAGAGGCACCTGGTGGCTGCTTCGCCCACAACGTTGGCTTCTTTCGCGAACACGGCAGCCACCGCTTCGAACGGTTGAA
TAGAGCTGCTATCACGTTGTCTTCGAGGAGGTGAAGCACCAGGGAGAGAGATCGTTGGGCACGGTAGGACGTATAAGGCAATAGCCGATACTAAAATCAC
GCACGCATCCGTTATCTTGGCATGTCTGTCCCGAAGACGAAGGCAAGCGTAGGATAAAATTCGTGGTAAAATCTTCGCTGCTTGAACCGAATGACACCGA
CAAAGAGCTGCTATGAGAAGGACAAGCATTCGCCGTGTGGATGAGCGGACGGGTTTCTACAAGTGAAGTTAGTGTTTGCCAAACTTCACTAAATAAAACA
AAAACATCATTTACCTTGTTTTTCTCGATCAACCCATACGCTTCCTTCACCATTGCTGGGTCTAGTCCGGGCAACAGTTCACTGCACAAGGGATAAACTA
TTTGTTAGAAGACTCGGTTTTCGCAGTATTCCAGTCATTTTTTACATGAGCGTCGCAAAGGCTTGGTGTTGCGTGTCTCGATCTTCCAAGCGGCCGATTA
AAACGTTTAAATGACACATTTCCTGTACTTGTCGCTCTTTCGTTTTACGGCCCAGCTTTTTCCTCTTGATCGTTCCTTTGGGACTCAAATTGCCTGTTGC
CGAACTACCTCCAAGCTGCCCAATGCGGCCTGTTGCCCGTCGCTGGAAATTCGACTCCATCATGTTTTCCAGTTCGTCCAAGTCAAAAGCTAAACGAATT
GAGAACCGGGATTCTCCTTCTTCGAGTCCGAAAGTATTTGCGGCTTCCCGACAGAAATACAGTCTATCTGGGCTAAATTTGAGATGACACCCTCAACGTA
TTGGTAGTTTATGCCAATTATGCTTGATCAAGACCGTCGGACCATTTCCCACCTGTCCCTGTTGGATCCATGGGGTCCATAGCACCATCGTCATGCTTAC
GCCGCTTAGTTTCGTGCCTCTGAGTGGCGGAAAGTTGTGTACCTGCTGCAGGTCGTTTGTTGGATGAAGAAGTCGGGTGTGATTGGCCGTTCCTCGCTCT
AGTGTCCACCTTGGCACCCCCACAGTTTTTCAGGATGCTGTCAAGTTTCGCCTTCGCCTCAAGAGCTTGTGCTGACACCAGGAATTCAAATCACACACAC
GTAAAGTCAGATTCGAGGCTGTATCCATGTGTACAAATATCAAATTGCCTTACCCAACGATACACTGCGAGCAACCGGCCGTTCCCAGGACGTCGCGTTT
GTTGTCCGATTCCAGAAGTAGACGTCCCCACTGGCTGGATCGCTTACTTCTTCCCAGTCCCTACAGCCAAAGTATAATGATCAATCCCAATATCCTGAAT
ATCAACCACTACAGCCAGAAACATACTCAGCCAACTGGTCTCCAGCCGTCTTCGACTCCGTGGCCTTCACTTCTGTCGGTTGCTCGGAAGAACTTCCAGG
TCGCTCCCACGCCGTCTCGTTGGTCAACTACAGCCACAAGTTGCCAATTAAATCATCTCCGACGCATTGAAATACTCTGAACAACTGCCACTCACCTCGT
TCCAATAGTACACGTCTCCCGAAGCAGGGTCTACCACCTCCTGCCACAATGCAGGTAGGGCGTTATATTCTGTCATATTCGACTCGGTCCTGTAGCTCTC
GGTTTGCTGCTCGATCTGCTGTGTTTTCTGCATGTCCTGCGCCCGTCGAAGTGCCACAGCATGGAGCGTGTTGTCCCTCACACGAGGATCGTTTTTATCT
GCAGCGGACGGTTCTGTAGGCTGTGAACCGAGCACACGACGTTGAGCTACTGAGGTGGTGGCATTGGCAGTCTGTTTCTGTCGTATTTGCTGCTGCTGTG
CCAGCTCTCGCTGGCTAGGGCCACTGCCGGTAGTTTGGAGGTACTTTAGAGCTTGAGCACGGGCTTTTTGGGCAGCTAGTTCCTTCTTGAGGCGCTCTCC
AGCGACCGCAGTCTTTGGCGGCATTGCAGACGATA