Description :
From Genome Similarity Track
Location :
Scaffold_46:79322- 80767
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G012943Similar to AVT1: Vacuolar amino acid transporter 1 (Saccharomyces cerevisiae)

Sequence
1445 bases(100 bases per row)
GTTGTAGTAAAGCTGGCGCTCCTCATCAGGGTGGCAGAACGGGAACAAGATCGCGGGGTCGACTTCGTCTGGGTTGAACAAATTCTTGCCCGAGTTGTAC
GTGACGTAGCAGCCCAATATGGCGCACACGAGGGCACACGTGATCGCTGGGATCTTCTCGTACATGGGAATCGACTTCCACATCACCTTGACGTAGAAGA
TGATTGGCAAGATGATGCAACTCAGCGACATGGCCGACGAGCCGATGAAATCCTGCAAATCTGAGAAGTCGTTACGCAACACGATCGCGATGATGACGAG
CACGACGATGATGGCAACACGTAGGAGAATGTACTTAATGACGTTCGCGCCGCGGTATTCAAGCAACTCTTCCTCCGGGTCCAGCGACACTTTTTCAATG
TCAGCGACCGACACGACCGATCCCTTAGAGATGCGTGACTTGAGCTCGCTACGGGCGCCTGGGGTTTCCGAGACTTGGTAGTTGAGCGATTCGATGTCGT
TGGGCTTTGGCTGGTGCATGCCCAAGAGCATACGCTCCGACAAGTAGAATGCAGGGGAGATGATGACAGCGAACGCGATCGTGATGTGCAATTGCATGCA
CAAGTATGCGAGGATAGCGAGCCCCTTGTTCGACGAGAAACCAAGTTTGCTCAAACCGGTGACGGAATCAGGGAAGATGGAGAACAGCATGTTGCCCGAA
ATCTGGCACCCGACTACCGAGTACCCCGTGCTTGCCAAGACGAGGAACAAGCACGAGATGAACGTGATGGTGACAAACACGATACGAGGCATACGAGTTG
GATCGCTGTGCTGGCGTTGGAGAGCAGGGATCACGATACCGGCGCCATAGGCGAGCGACAGGTTGCCGAAGGTGGTGGCGACTTGCTTGAACGAAATGTC
CGGGCTTGGCACGGAAGGGTGGCCACTCATGCCATGGAGTAACATGCCCAACGCGAGGAAATCTGCAACAAGCGTGCCGACGCAGCCAGCGAAAGCCGCC
GCGGCACCTTCCTTGAGCGTTGGTGTCAAGCAGACTGGTGTGACAGAAATCGCCATCAAGATGATCCATGTCGATTGACTGAACGCGCCAGGGAAGAGAC
TGTCGAGCAACGTACCGCCAAGCACGAAGTACCAGATTGGAATCGACAGGCAGTACCCCATTTGAGACACCACGACCAACCAGCGACCGACCTTGCCCAT
GCAAAAGTCGCCGAGATCACTGTAGGTTTTTACTGAGCTTGGCGCGAGGAGCATCACCTTGGAGATCACGACGGACGCGTAGACGTTGGCGGCAGCCATG
AAGAGCATGGCAAACACGGCGATCATTGGACCAGCGCGCGAAAAGTTGCCCGGCATACCGAGCGTGCCCACCCCGTAGACACAGCAGAAAAGGTTGGCAG
CGACCTTGGCGTCTTCTAGCGTAAAAGGCGGCTTCTTCACCATGG