Description :
From Genome Similarity Track
Location :
Scaffold_353:7932- 9675
Transcript NameFunction/comments
Hyaar_Emoy2813854acetyltransferase (GNAT) family, putative

Sequence
1743 bases(100 bases per row)
TCGAGGCAAGACTTTTGGTGTGCAGCTTATGAACGCCATTGAGCAGCACGTACGCGAACGCGTTGACCAGTTTGTTCTGTCCTCGCAGTATGGACGGAAA
GCGTTTTATGAGAAGTGCGGTTACAGCTGCACAAGCGACGATATTTACTTGGAAGAGGGCATTGAGCACTGCTGCATGGTCAAGTCAGTTAAATATTAGA
GTGACTAGCATGAGACGAAGCGTGGAGATGCACGCTGTAAATGCGCTTATCACTCTGACTAGCGTCTGATTCCACGACTTGTTCAAGATGGAAGCTCTTC
GTATGAAAGCGCGGCGCTTGGACGACGGTATACGCTGCCTCTATCTACACGTACGACGCTAAAACGTCTTCTGAAATGTCCTATCATTCAGCTGATGCTA
CATACGCGACGCTGATCAATATAACCTTGTGAGCTACAAGTATTGATAGTGTTTTTTGTCAGCTGTGAGAGGCGCTGAATTATGAGAGCTCTCATGCAAC
AGACAGCTTAGTCCCTGCCAACTCGACAGCTTCTAGGCTACAAAGTTGGCCTTGTTATCACAGGACAACGTGTCGGCATATCCTGTCCAGATTTCTCCAC
TGCTGCCTCGGATGGCAGCTTGCTCGCTCGATGACCTGAGACGGGTAGACACGTAGCGTATAAAATTGAATACAATAAAATTGTATACAACTAAAGCTTT
TAGTCTAGCCATCTAACTTTACCTTCGTCTGCGGTCTTTCAGCGGCGCTGCTGTTCATAGTGCAAAGTGGCGGGTGACAAAGCAAGAGGAAGAAGACATA
TGTCGTTGACTTCTATCGTTCTGAATGCCGTAGTGACAATCTGCGTTTCGACTTATTTTGTGAAAGGTTTGTGACAAACTTTAGTGGACCTACTTCCAGA
TTTTTGCGAGTCCAGATATGTTACACTATTTATCGTACTGAGCCCTCTATTACGATCTTCACGCGATGGGATAACGACGACAACAGGCGGTGACAAAGTG
TACCCAGTCATGTCTACTCCATTTTGAATGGAAACGTCTATCCTCACACTTGAGTGTTCCAGTAAGCTAATTTTTGGTGGCCAACAATACTGCAAACGGA
CTCCTAAGCTGAAGGTTGGGTTCCCGTCGCGCACTGTAAAATACCAACTGTAAGGTAGAGTCGAGTATGAGAAGGAGGTGTGAATGCAACGGTCTTTAAA
GTCGCAGAGGTAGGTTGCTGTCGTACACAGTTGGAGACGACAACACATATATTGTAGTAGGATGTAGGAGTTTGTTTAAAAAAAGAAGATAATGAACGTC
AGTTCCACAGCTACGTTGAAAACGGAATCAGTTTCTCAACACAACAGGGTTATAATCCTTCCACAAACCACTGTGGACACGCTTCGGCCGTGAATGCCCC
AATGAAGGATAGGAAGCTATACACCAAAGATGGTGTTCCAGTCAATTGGAAGGGATAATTAGAATGGAATATTTTGGCAGAAGTACATCGAGATTATGAA
TATGGCGGTATAGGACATGGATGACGACGACGAGTATTGGGATGTGGCAGGTGCGGGTGCATCAAGACCGAATACTTATCGACCGATGAGGGTAACTTAA
ACCTTTCCAAGATGGAGGGAAAGATTCGTGCAACAATTTTGATGTCGCTCTCATCCGAACGCTCTGTTTAAGGAAAAAGTAGAACTGTATTTAATATAGT
TACGTTTCTTTGTAAATCGTCTTTGTCGTGATCTAACTATATT