Description :
From Genome Similarity Track
Location :
Scaffold_13:79262- 82408
Sequence
3146 bases(100 bases per row)
ACAATTGGCGATTAAGGACTCGGTCATTTACGAACTGATAATAATCAAGGCAGCTTACTTGACGCGCCATAGATTAGTGCACGCGATTGAAGGCTCCGTG
GATTATTATGGATTTAAGAGAGGTATAAACAAATAATTTGGTGCTGCAAACAGCGGCAATCAGCCCCTTATTAAAAATTATATCGTGACTCAATGTGGTC
GATGTGAACGGCCTGGGGATAAGCCAGACTTCGGTGCTACATTAATGCTTACGCCTCTTGCTACTTTGAACGGGCAAGTGAGTAAACAGTAATGGTGAAA
TGAGCATTTGGGATCTTCTCCTGACGAAATTGGGCGTTTTTCTGAGCTACTTCTGATAACGAATCAGAATGACCCAGCCAAAAAAATATGAATCCAGCCG
TTAAGCGTTTGCCATAAATATTTATAGGAAATTGATAGTTACACCCATCCTTTGATACGTACATACCTAGGCGAACTGTTTAAATTAATCGTTCGCCACA
AATTGTAACGTAAATACATAAAAATCTAAGTTATATTATTCTTTATTAAACGTGCGAAACGTTCGACTCGTCTGCATTAAGTACTTCGAAGCAGTTTTGT
TGTGTCCAATTGAAGATATGGAGTTTCGCATTTGGAGCCAAGCCTGTTGGCCTCGGTGATCAACGAAGAACAAGTGTATTGGACTAGCAGCAGCAAAAAC
AGGGACTATTTAAGATGTGTGGGTCAAAGCATGGCAATAATGAATTTTATAGACTCACGAATCAGGCAGATTCCTAGATCAACAGTATTTATAGCGATAA
CGGAGATACTTCCAAATCAGCCACAGTAGTGGTTTATCTTTCGAGTTGACTGAAGTGAGAGCTTGCAGCTCGGTTTCGAATATTCTTGGCACATACATCT
TTACTGCGCAACATAATCGTGCAAGAACCCGATGCATCGCGCCAGCAGCTCATTGTATACCGATGTCACCACTGAACTGCAGCAACCATTGACTAACAAG
CTCAGCTTCATATCTCCAAAACGGAGGTTCAACCGCTTCACACTATAGGATACATACAACAAGGCCACAAAAATGATGCAAAAAGTAGAGACGCAGCTTA
GTCTCCATGTTTTTGTTCCAGTATGGACATTAACTTCTTTCGGTGTGGACGTCGCACTCGCCTGTAACTGTGGCTGTAATTGTGTCAGCTCTGTTTAAAC
GCTTCTCCAGACCATTGCAGAATTTGCAGTAGAAACGCGTTAAGCGCTTCACTTGCAGGCTCACCAGTTCGTTCGTAGAATAGTACAGCCTGAATGGTAT
CGTTATGGAGTGAAATCATGACGAGACCGCCAGAAGAGGTCTATATATGACCAGATTATCAGATCAGTTCGACTCCTGAGCAGTACAAAATGTTATCCCG
TATTTACTGGCATAAAGTTGCTGATGCTCTGTCGGTCCTTCTTGTCGGTTTGACTCGGGTCAAAGTGCACTTGGACGAACTCTAGAATGTTATTATACAG
CATACAGCTAGAGAGCGTAAACATGCACAACGTATACACCGAGCACGGCCCGCACCTCCACCGTCAATCTCGCGCGCGTCCTGCGTAAATGACATGACGA
GCGCGTCGACACCTTTGGCATGTGCTTGTGGTTTCCACTTCCATTGGTGTGTGAACAGACACCCCCCCGACTACTGATGCTGCACCTTGACCATGTGTGA
TTCCCTCAGCAGCGCATTCATTGTCTTTTTGTGCAACGATTCCACCCGAATGCAACGTATTTTGTAAAATTGTATTTCTATCGACCAGTTTCTGATTCGA
CTCGGCAAGAAATTAATAGCATAGATGAGTGATATGAAGGCCACGGATGAATTCGACGGCGAGGTTGTTTAATCGTTCGAGAGATATCCGGACGCCACGG
AAGCATCGAACGGATACGCACTGACAACTGGAGAAGAGAAAATGAACCATTCGTACGTGGGTACGATGGACGGCGGCAACACCCATGCCAGAACTCGGGT
CTACGGGTCCTTATGCTGCTCTTGTCATTTTTATCGGGGTGCATAAATCATCAGCGTCACGTTTCTTTATAGACATTATTGTGATGACGGATGACTAACG
TAACCTGCTGCACGCTTTGAACTCCGGGACCATAGATCGGATGCTTCGACAACACCTCGAAACAATGCTCGAGCGAAGTATGTTCGCAGTGCTGTTTAAT
AAAGAATAATATAACTTAGAACTAATGCCTTTACGTTTCAAGAATAATATAACTTAGAGCTAATGCCTTTACGTTTCAATATGAGGCAAACGATAAATTT
AAACAGTTCGCATGGGTGTGTACGAATCAAAGGGTGGGTATGTACCTATCAGTTTCCTATTTATAAAACAACAAACTCGTCGAGCCTTTTTTTCGGTCTC
GACAGATTTATGGTGCTCATAAATGGGGTTAAAAATTACGTTTATGGGGTTACTATATACACTATTTATAAATTCGGCTTATCGGGGTTTTAATAGTTAC
CCAGTGGGGTTTTCTAGATATCTAACGACTACTTCCTTTTTCAACGAGCCCTACTATTAAGGCCCTACACATTCGTTACCGGAATGCCACTAATTACCAG
AGTTCTAAATCGGAGCTTACCGCACCCACCAGTTGGTTAAAAAAACCTTGAGCGGATCGTCGTCTTATTGAACTTGAGCATCTGGTACAAATACTCGTCG
TGGCCCCAGGCAAACTTGAGGTTCCTGAATCCACAGTGAGATTCGTACATGCCATACTTTGTGTTATACCTCGGATTGCTCATGTCCGGGTTCGTCGCGT
TGTACGTCGGGAAGACGACCGAGTCGGGAATCCGGCAGCCCACGACCCACGTGTCTCCTCCGAGCGCCCATTGATCTCCGTGTGCAGTGCCCTCTTGGGC
GGCCTCATCACGGCCCCTGATGTACTGGGATCTTGGCCATGTCGTGCACGATTCCAACGAGCTGGAACACTTCGGGGTGCCCAGCAGCGCGGATGCCCTC
GGCCGTCTGCAGCTTATGNNNNNNNNNNGCAGCAGTATTCAAGCCACATCGCGGCTCAACAGTTAAATCAAGCCTGGCGCGGGGGCACGTCGACTTTCAG
TTTGCGCCGAGCTCCCTATTGAGGAAAGAAATAGGTTCTGTGGACT