Description :
From Genome Similarity Track
Location :
Scaffold_239:7926- 9588
Transcript NameFunction/comments
Phyke_g7067hypothetical protein PHYSODRAFT_515318

Sequence
1662 bases(100 bases per row)
ATCCTAAATAATGTATGGGGCAGGTCCGGACCTGGAGAACTCACAGCCATTATCGGCCCCTCAGGAGCTGGCAAGACCACTTTACTTGATATTCTGGCTG
ACCGTCTACAACCTGGTGGCCCTGGTGTGCGTGTCGAAGGCATTGTGGACGTGAACGGCCAACCGCGAGATCCACACACTTTCCACTCCATCATGAATTA
CGTATCTCAAGATATGGCATTCCTAGGGTCGTTCTCTGTTCTTGAGACTCTGCAGATCGCCGCAGGCCTTGGCCTCCCAAGTTATGTCCCCACCCTCACT
CGTGAATCTCGAGTGCAGGACGTTATTGATGCCATGGGGTTACGAACCTGCATGCATGCCAATGTTGGCGACGTTTTCCACAAAGGAATCTCTTCAGGAC
AGCGTAAGAGACTCGGTATTGCAGTGGAATTGCTTTCGGACCCATCCCTGCTACTGCTTGACGAACCAACCTCAGGACTtgacgcttcttcagctcgaaG
CGTGATGCAATACATTGAAAGGCTGTGCCAGGAGAATGGAAAGAACGTCGTGTGTACGATCCACCAGCCATCGTCATCCATTTACGACATGCTGACGAAC
CTGGTGATCTTGAGTGACGGCGAGTTGGTATACTTCGGTCCGACAAACGTTACACTTGCACATTTTTTCTCCATGGGCTACGTGTGCCCCATGTACTCTA
ACCCGGCAGAGTATTTCTTGCACCTGGTGAACGCAGACTTCCACCCAAATTTGCAGCTTGATGCTTTTGTGAACGCACTTGAGGAGGGGCCAGGACCACA
GCGATTGCGTGTAGACATGGCTCGAGACCGCTCAATGCGAGATTATCTCATAAACTACGAAATGCTGCGCGCCTTGCGGCCGTCGCGACTGGACCAGTTC
AGtgtactgctgcatcgaAATTTGTCCAACAATTGGCGGCATCCTGGTGTGTTTTGGCTACGAGTACTCATGTACGTTTTGCTGTCGTTCATGGTCGGCA
CAATGTATCTGAGCTCGAACCAGAAGATCACTAGCGCTGCAATGGTCCCTCTGCTATTCTACGTTCAAGctttcttggtcttcatgtCCGTAGCAGCTat
gccagcacttctggaGCAGCGAGCCGTCTTGGAACGCGAAGTTCGTTCGAATTCCTTACATCTGTCAAGCTACACGACTGCCAACCTCCTTGGTGCACTG
CCCGGCATCACACTCATCTCACTCCTGGCGTCAATCATCGTCGTGTACTTTGCGCATGTGCATTCGTTCGGATCGTTCTTCCTGAACTTAACACTGTCGC
TCATTGCTGCAGAGTCCATGATGCACCTGCTAGGCGCTGCTGTGCCCCACTACATCATGGGCATCGCTTTGGGCGCTGGTCTCTTCGGTATGTTTATGCT
TTGCGAAGGCTTCATGGTGCCGTTCGCTGCCATTCCCGCATATTGGCGCTGGGGCTACTACATCGCTTTCCACACGTACTCGTTTGAGTCTTTCATGTAC
GAACACTTCTCAAATGAGAACACGGAGGAGGCGTGGAGGCTACTCAAGAGCTACGGCATGGAGAACGTCAATGTGCCTCGCAACATGCTCATTATTGTGG
GCTATGCTGTAGCGCTGCAACTCGCCGCCATCGTCGTGCTCTTCCTGCGCTTCGGCCGCCAC