Description :
From Genome Similarity Track
Location :
Scaffold_778:7925- 9287
Transcript NameFunction/comments
Phypl_g10914hypothetical protein

Sequence
1362 bases(100 bases per row)
CATAATCCGGTCTACTCGACAACGGGTCGGCCAGAACGTTCCGCTGGCCAGGCTTGTACCCCATGTCGACGTTGTACTCCGTAAAGAAGGAGAGCCAACA
AACCATTCTCTGAGAGAGATGAGGCGACTGCGTCGCAGCGCGTAGCGATCCATGATCCGTATTGATCACAAACAGCTTAAGAGCCGATCAGGTGAGCCCT
GAATTGACAAACGCATACTTCATTGGAAGTAGCTCTTTGTCATGAACTGGATAGTTACTCTCAGCAGCGATAAGCTCGCGAGATTTAAACGCAATCTCGC
ATTCACTtccttcagcgcctgcttgcAACAAAACACTGTGAATGGCAAAGTCCAGTGCGTCACTGACGACACTGAAAGGACAAGCGGGGTCTGGTAGCGC
CAGGATCGGCGCCTGATGGAGACTCTGCTTGATGGATTCAAATGCCGCTTGATGTCCGGTATCTCAACACCATTCCACATCCTCCTTAAGGAGTTTGGAC
AGAGGCCTTGCCACATCAGAGGGATGTTTGCCGTACTTGTGCAAGTAATTGGCCAAGCCAAGCCAATTTCGTAAATCCTTCTGGTTCTTTGGAACTGACT
CACTGTGGTGGCCTTGACCTTAGCAGGATCTGCTCGAAGGCCTCGCTTCCCAAATGAAGGTTTCCAGAAAGGGAATCTCTTCAGCGCCGAAGCTGTTGGC
ATACCACTTGTTTGTGCACATGAACTCGAGCACCGCTCGCAGGTGCTCAATTTGGTTCCCCAGGACAGTACTTCCGTGCACCACACGACTGTGGACGAAG
GTGCCGTCGAAGTATGTCTGAGCATACACCCTGTGGGGCCTGAACAGCTGCGTTATAAGACGATTGAACGTCGCAGGTGCGTTCGACACTCCTTTGGGTA
TTTCAAGCCACTACCAGAGCATATCTTTCGGAGCGCTGACCGCAGTAAGCGGAATATCGCTTGCCCTCATGAGCAATTGATACTACCCATCGACCAAGTC
GAGGGCACTGTACACCGTACACCCCGTCATGTTGTTCTGGAGAACATCCATCCTAAAAACAGACGTCTGCGCCGGGATGGTGGCCGCGTTGAGCTTGTTG
AAAGCGTGAACGATAAGCCACTTGTCATTCGACTTTCTCAGACGGATGTAGCCATTAAGTACGGGGTCTTGCTCTCATGCACCATACCTGCCTCGTGTTT
GGCACAGAAGAATGCGCCCATGGCGTAACACTGTTCCCGTGGTGAAGGACACTGCCTTGTCACGCCGTATTTGGATCCGGAAACCAGGTCACTCTCGTGA
CGTACACCTCGATCAGGAGGTAGCCTTGTCAGAGGTTCTTTCGAGACCACGTCTTGATACTC