Description :
From Genome Similarity Track
Location :
Scaffold_337:7920- 10308
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_337-snap-gene-0.14ATPase
Pytir_DAOMBR486maker-pir_contig_337-fgenesh-gene-0.6Kinesin

Sequence
2388 bases(100 bases per row)
GAAGTAGCAGGAGCTTCAGCGCGCGATGATTCCACTGCCGATGCGCCAGTTGCCGCCACCACCATTGCGGCAGCGACAGCAGCAAGTTGCCCGAACGACA
TACCTTGGTATTGCTGATCGTGATGCGTCAACTGGAGCACGGCAGCGGCATTGCAACTAGCACCACCGCTCTACACAAAACCACGTCGATAGTAGTCAGC
CATCTTGTACACAGCCACACTGCATGATCGACGTTCTAGAAATCCCAATCCCAATTGCTTTGCGTACCTGCACGACTGCAGTCGTCGTCGCTGCCATTAA
GCGCTGTTGGTGCACTGTACCACTGCGACCCACTTGCGCGAGCGCTTGGAACTGGCGGCGGGCGCTCCATTGCAAGTTTGTAGCTGCAGAAGCAGCAGCA
GATGCGCGTTTGGCGCTCGTCATCCGCATCATCATCGTCACCATGAGCAGATCGTTTTTTGAGCCAAATCGAAGTGTGCTTTTCTATCGCGTTCTGAAGA
AGAAAGGGGCCACTATTCAAGGCATAGCGAAAAGTTCGCACGCGCACTTTGCCACCGAAATGCAAGCATTCTGGAGCCAGAAAAGCTGGTTTGCGAGATG
GATACACTTTTGCCAGCTCAATTTGCAAGGGCATCGTATCATTTTCACAACAATCCCCTCCCTCCCTCTCTGCATGGCTACGACGATATGAAGCGGATGG
GAATGTTGATTGACGCGCACACAGTTATGAAATAGATATGAATATAAAGTTAAGGTCCTTCCTTCCCTCCCAAGGCTCTTTCTGATGACGCAGGCAGTGA
TCATGGACTCGGAAGCAAGTTGTGAAATGCTGACCATCAGTTTGAATTTCCCACAGGCGACAGAAGACAGACTGAATCGTGCTGGTTTCGCTCAGTACGT
TGGCACCTGGTTCACTCGCTTCGACGCGCTCTCTTCTTCTTCGCAGCGCTTACGGAACGCCACCAGCTGCTTCCGCAACTCGCCGATCGTATTCGCTTTC
TGGGCCAAAATCTGCAGACAGCAGGAGAGAAAACGATATTTGCGTCAGCTCTTTGCTGCAGGAATGAATAGGAATGTTTTTGAGTAAAAGCGTCACGTCA
CCTCGTCGAGACGCGTGATGTACTTGTCGATGTCGTAGTCCACCACGTTGTCCCCTTGGATCTCTGCGAGCAGCTGCCCTTCCTCCGTCAAGAGCTCTGC
GCTTTCCTGAATTGCATTCATGTGCGAGTTCAAGAGACTCTCCTGCTCTTCGTAGAGAGTCTGTACCTATTGTGATCAAGATAAGCAACACATATCGTCA
GTTTAATGAAAAAGGCTACGTAATAGGGAAAGAGTGGCAACTTACCACTCCATGAAGAGCTTCGAGGTCGTATTCGCTCGCATTCTCGGAATTAGAGCCG
CCTGTTCGCAGACAAAAGGTCATCGTCAGCAAAATGATCAACGCAGGCAGAGGTACGCTCGAGTATAGCCCTGTGACGCACGTGACTGCTTTCGGAGGCT
GTGGTGCAGAATCTTAATATCCTGACTGGACACTGAGTCCGATCGATATCGATGCGCTTCGCGTAGCTCGTCTTCATCATCCTCCATTTCTTCAGGCTGA
CCACTCTGCTCCTCACCGTCGCCATCACCATCTTCGTCGTCGTCAAAAGGCTCGTCATTGTCATCGAGGTTCTCACGATGGGACCGCATTGGAGATTCGG
CCCCATCTTCAACGTCTATGTGTTGGTATAGCGATTGTCAGTCAGTTCTCTAAACAGGATGCTCTTTTCTATTTCGCATTGTACAGCTAACCTGTTTCAA
AGTTGACGTCATTGAGATCCACCGTAGTCGAGTCTGCGCTACCTTCCTCGAATGCATCGGCGGACACGTGCTTCTCCTTCACTCGGTCGGCGTAGCGGAG
TGTGTTCACGGTATGGTCCGAAGAGGACGAGCATGGCGACACAGCGGCGATCATCACGGTCCTTGGATTTCAATTGCACACACAGAGTCAGTCTTCCTGA
TTGAACCGAGCACACGACTGCGATTGAATCAATCATTCTCAGATAAAATTCTCAAACGTCTCACCTTGCTTTCGCATTCACGAAAGAGTCTTTCAGCACT
TGAGTCAGCTTGCTCGCACGGAACGGAATGTGCGCGCCACGACCGCCGCTATCGAGCGCTCTGCATAAAAGTAAACCATCGCCACATGTCAGTGTCACCT
CGCACAAGTAAACCTGCCAAAATGGTCAGGTCAGCATACCGAAAGCATTCCTTCAGTGCCAAGAGGCTCTTGTTGATCTCCGAGGACTCCATGCGGCGCT
GGCGGTTGTGGTTCTTCGTGTCTTCACCCCGCTCGCTACCCGCGAGGTCAATCAGCGATAGCTTCCCGTACAATTGCGAGCTCCCACG