Description :
From Genome Similarity Track
Location :
Scaffold_1832:792- 3499
Sequence
2707 bases(100 bases per row)
TTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGG
ATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTTACAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGTCTCCTTCAGAAGGACGT
CGACTGGCGCTGGGAGCAAGAGCACCAGGACGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGAGGAGACGAAGACG
TTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGGTGTGCATTGCTGCAGGCCGACACGGCCGGACATGAACGAGCCATCTCGTTCCAGTCCAGGC
AGCTCAAAGCCGCCGAACGGAACTACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCCCG
GCCCTTCGTGATCTACACAGACCACACGTCCTTGAGGACGGAAACTAACTCGCCTCACCACTTTAAAAGGATGGCGAGGTGGCTGTCCTTCTTCACGGAG
TACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGA
CAACGGATCTATATGATCGGATACGCACGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGA
CTGGCTCTCGTCGCGACAGCGCTCACGGCTCCGCCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTC
GTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCACTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCAGTCT
CTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGC
TCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGTAACACCGGAATT
TTGGTGTTCGTGTGTCGGCTGAGCAAGATGTACCATCTTGCTCCAGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGCTGTTCGTCGATGGCGTGT
TCCGCTATCACGGTCTCCCAGAGACGATTGTCTTAGGGACCGAGACCCACGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGT
CTGCAGATGTCCAATGCGGACCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCAC
CACGTACGTGGTTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCC
GCCACCCCAGAGTGCCTCTCACGCTTCGAGGAAACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGT
GAGGCCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAA
CAAAAGGAGTACTCGGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGATTGGTGACTTAGTGTTACTAGACACGAGGAACCTACCTCTAGACACGG
TTAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTC
AATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCGAA
GCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCT
CCATACGAACGGACCCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGA
CGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGACCCGGCGGTCCACCCGCAGGTGCAGGCTCGCGACCT
CTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAAT
CTCAAGCACGAGGAGACGTTGACGGAGGCGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGAACGAGAGTGGCTCTCGGGAGGCGCC
GAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGC
GGGAAGC